diff options
153 files changed, 1242 insertions, 577 deletions
diff --git a/CONTRIBUTING.md b/CONTRIBUTING.md index 32201333c37ba..06b9c10dfec6f 100644 --- a/CONTRIBUTING.md +++ b/CONTRIBUTING.md @@ -565,7 +565,7 @@ Names of files and directories should be in lowercase, with dashes between words - Do not use tab characters, i.e. configure your editor to use soft tabs. For instance, use `(setq-default indent-tabs-mode nil)` in Emacs. Everybody has different tab settings so it’s asking for trouble. -- Use `lowerCamelCase` for variable names, not `UpperCamelCase`. Note, this rule does not apply to package attribute names, which instead follow the rules in [](#sec-package-naming). +- Use `lowerCamelCase` for variable names, not `UpperCamelCase`. Note, this rule does not apply to package attribute names, which instead follow the rules in [package naming](./pkgs/README.md#package-naming). - Function calls with attribute set arguments are written as diff --git a/maintainers/maintainer-list.nix b/maintainers/maintainer-list.nix index cba46849dbd14..855357675a8dd 100644 --- a/maintainers/maintainer-list.nix +++ b/maintainers/maintainer-list.nix @@ -6622,6 +6622,12 @@ githubId = 4656860; name = "Gaute Ravndal"; }; + gray-heron = { + email = "ave+nix@cezar.info"; + github = "gray-heron"; + githubId = 7032646; + name = "Cezary Siwek"; + }; graysonhead = { email = "grayson@graysonhead.net"; github = "graysonhead"; @@ -11667,6 +11673,13 @@ githubId = 149558; name = "Merlin Gaillard"; }; + mirkolenz = { + name = "Mirko Lenz"; + email = "mirko@mirkolenz.com"; + matrix = "@mlenz:matrix.org"; + github = "mirkolenz"; + githubId = 5160954; + }; mirrexagon = { email = "mirrexagon@mirrexagon.com"; github = "mirrexagon"; @@ -17997,6 +18010,12 @@ githubId = 15064765; name = "tshaynik"; }; + tsowell = { + email = "tom@ldtlb.com"; + github = "tsowell"; + githubId = 4044033; + name = "Thomas Sowell"; + }; ttuegel = { email = "ttuegel@mailbox.org"; github = "ttuegel"; @@ -19349,6 +19368,11 @@ github = "ymeister"; githubId = 47071325; }; + ymstnt = { + name = "YMSTNT"; + github = "ymstnt"; + githubId = 21342713; + }; yoavlavi = { email = "yoav@yoavlavi.com"; github = "yoav-lavi"; diff --git a/nixos/doc/manual/release-notes/rl-2311.section.md b/nixos/doc/manual/release-notes/rl-2311.section.md index 6780be9b58147..fd5074b5aeec4 100644 --- a/nixos/doc/manual/release-notes/rl-2311.section.md +++ b/nixos/doc/manual/release-notes/rl-2311.section.md @@ -254,6 +254,8 @@ - Garage has been upgraded to 0.9.x. `services.garage.package` now needs to be explicitly set, so version upgrades can be done in a controlled fashion. For this, we expose `garage_x_y` attributes which can be set here. +- `voms` and `xrootd` now moves the `$out/etc` content to the `$etc` output instead of `$out/etc.orig`, when input argument `externalEtc` is not `null`. + - The `woodpecker-*` CI packages have been updated to 1.0.0. This release is wildly incompatible with the 0.15.X versions that were previously packaged. Please read [upstream's documentation](https://woodpecker-ci.org/docs/next/migrations#100) to learn how to update your CI configurations. - The Caddy module gained a new option named `services.caddy.enableReload` which is enabled by default. It allows reloading the service instead of restarting it, if only a config file has changed. This option must be disabled if you have turned off the [Caddy admin API](https://caddyserver.com/docs/caddyfile/options#admin). If you keep this option enabled, you should consider setting [`grace_period`](https://caddyserver.com/docs/caddyfile/options#grace-period) to a non-infinite value to prevent Caddy from delaying the reload indefinitely. @@ -396,6 +398,8 @@ The module update takes care of the new config syntax and the data itself (user - Suricata was upgraded from 6.0 to 7.0 and no longer considers HTTP/2 support as experimental, see [upstream release notes](https://forum.suricata.io/t/suricata-7-0-0-released/3715) for more details. +- Cloud support in the `netdata` package is now disabled by default. To enable it use the `netdataCloud` package. + - `networking.nftables` now has the option `networking.nftables.table.<table>` to create tables and have them be updated atomically, instead of flushing the ruleset. diff --git a/nixos/modules/misc/ids.nix b/nixos/modules/misc/ids.nix index dc59ccb357d44..5b278b5e80625 100644 --- a/nixos/modules/misc/ids.nix +++ b/nixos/modules/misc/ids.nix @@ -69,7 +69,7 @@ in #dialout = 27; # unused polkituser = 28; #utmp = 29; # unused - # ddclient = 30; # software removed + # ddclient = 30; # converted to DynamicUser = true davfs2 = 31; disnix = 33; osgi = 34; @@ -394,7 +394,7 @@ in dialout = 27; #polkituser = 28; # currently unused, polkitd doesn't need a group utmp = 29; - # ddclient = 30; # software removed + # ddclient = 30; # converted to DynamicUser = true davfs2 = 31; disnix = 33; osgi = 34; diff --git a/nixos/modules/module-list.nix b/nixos/modules/module-list.nix index 2c06f49317256..79918f71f7be2 100644 --- a/nixos/modules/module-list.nix +++ b/nixos/modules/module-list.nix @@ -884,6 +884,7 @@ ./services/networking/dae.nix ./services/networking/dante.nix ./services/networking/deconz.nix + ./services/networking/ddclient.nix ./services/networking/dhcpcd.nix ./services/networking/dnscache.nix ./services/networking/dnscrypt-proxy2.nix diff --git a/nixos/modules/programs/firefox.nix b/nixos/modules/programs/firefox.nix index 83a3edaf813ef..99236f01c5370 100644 --- a/nixos/modules/programs/firefox.nix +++ b/nixos/modules/programs/firefox.nix @@ -220,23 +220,20 @@ in config = mkIf cfg.enable { environment.systemPackages = [ - (cfg.package.override { + (cfg.package.override (old: { extraPrefs = cfg.autoConfig; - extraNativeMessagingHosts = with pkgs; optionals nmh.ff2mpv [ - ff2mpv - ] ++ optionals nmh.euwebid [ - web-eid-app - ] ++ optionals nmh.gsconnect [ - gnomeExtensions.gsconnect - ] ++ optionals nmh.jabref [ - jabref - ] ++ optionals nmh.passff [ - passff-host - ]; + extraNativeMessagingHosts = + old.extraNativeMessagingHosts or [] + ++ optional nmh.ff2mpv ff2mpv + ++ optional nmh.euwebid web-eid-app + ++ optional nmh.gsconnect gnomeExtensions.gsconnect + ++ optional nmh.jabref jabref + ++ optional nmh.passff passff-host; cfg = let # copy-pasted from the wrapper; TODO: figure out fix applicationName = cfg.package.binaryName or (lib.getName cfg.package); + oldCfg = old.cfg or {}; nixpkgsConfig = pkgs.config.${applicationName} or {}; optionConfig = cfg.wrapperConfig; nmhConfig = { @@ -246,8 +243,8 @@ in enableUgetIntegrator = nmh.ugetIntegrator; enableFXCastBridge = nmh.fxCast; }; - in nixpkgsConfig // optionConfig // nmhConfig; - }) + in oldCfg // nixpkgsConfig // optionConfig // nmhConfig; + })) ]; environment.etc = diff --git a/nixos/modules/rename.nix b/nixos/modules/rename.nix index 408c515044c80..0fbb2351f9863 100644 --- a/nixos/modules/rename.nix +++ b/nixos/modules/rename.nix @@ -54,7 +54,6 @@ in (mkRemovedOptionModule [ "services" "chronos" ] "The corresponding package was removed from nixpkgs.") (mkRemovedOptionModule [ "services" "couchpotato" ] "The corresponding package was removed from nixpkgs.") (mkRemovedOptionModule [ "services" "dd-agent" ] "dd-agent was removed from nixpkgs in favor of the newer datadog-agent.") - (mkRemovedOptionModule [ "services" "ddclient" ] "ddclient has been removed on the request of the upstream maintainer because it is unmaintained and has bugs. Please switch to a different software like `inadyn` or `knsupdate`.") # Added 2023-07-04 (mkRemovedOptionModule [ "services" "dnscrypt-proxy" ] "Use services.dnscrypt-proxy2 instead") (mkRemovedOptionModule [ "services" "exhibitor" ] "The corresponding package was removed from nixpkgs.") (mkRemovedOptionModule [ "services" "firefox" "syncserver" ] "The corresponding package was removed from nixpkgs.") diff --git a/nixos/modules/services/games/asf.nix b/nixos/modules/services/games/asf.nix index f15d7077d965c..432de6336ce24 100644 --- a/nixos/modules/services/games/asf.nix +++ b/nixos/modules/services/games/asf.nix @@ -187,29 +187,41 @@ in Group = "asf"; WorkingDirectory = cfg.dataDir; Type = "simple"; - ExecStart = "${cfg.package}/bin/ArchiSteamFarm --path ${cfg.dataDir} --process-required --no-restart --service --no-config-migrate"; + ExecStart = "${lib.getExe cfg.package} --no-restart --process-required --service --system-required --path ${cfg.dataDir}"; Restart = "always"; - # mostly copied from the default systemd service - PrivateTmp = true; + # copied from the default systemd service at + # https://github.com/JustArchiNET/ArchiSteamFarm/blob/main/ArchiSteamFarm/overlay/variant-base/linux/ArchiSteamFarm%40.service + CapabilityBoundingSet = ""; + DevicePolicy = "closed"; LockPersonality = true; + NoNewPrivileges = true; PrivateDevices = true; PrivateIPC = true; PrivateMounts = true; + PrivateTmp = true; # instead of rw /tmp PrivateUsers = true; + ProcSubset = "pid"; ProtectClock = true; ProtectControlGroups = true; + ProtectHome = true; ProtectHostname = true; ProtectKernelLogs = true; ProtectKernelModules = true; ProtectKernelTunables = true; ProtectProc = "invisible"; - ProtectSystem = "full"; + ProtectSystem = "strict"; RemoveIPC = true; - RestrictAddressFamilies = "AF_INET AF_INET6"; + RestrictAddressFamilies = "AF_INET AF_INET6 AF_NETLINK AF_UNIX"; RestrictNamespaces = true; RestrictRealtime = true; RestrictSUIDSGID = true; + SystemCallArchitectures = "native"; + UMask = "0077"; + + # we luckily already have systemd v247+ + SecureBits = "noroot-locked"; + SystemCallFilter = [ "@system-service" "~@privileged" ]; } ]; diff --git a/nixos/modules/services/misc/confd.nix b/nixos/modules/services/misc/confd.nix index 17c1be57ccbcd..17c1be57ccbcd 100755..100644 --- a/nixos/modules/services/misc/confd.nix +++ b/nixos/modules/services/misc/confd.nix diff --git a/nixos/modules/services/networking/ddclient.nix b/nixos/modules/services/networking/ddclient.nix new file mode 100644 index 0000000000000..8f4fb0bc78d4e --- /dev/null +++ b/nixos/modules/services/networking/ddclient.nix @@ -0,0 +1,234 @@ +{ config, pkgs, lib, ... }: + +let + cfg = config.services.ddclient; + boolToStr = bool: if bool then "yes" else "no"; + dataDir = "/var/lib/ddclient"; + StateDirectory = builtins.baseNameOf dataDir; + RuntimeDirectory = StateDirectory; + + configFile' = pkgs.writeText "ddclient.conf" '' + # This file can be used as a template for configFile or is automatically generated by Nix options. + cache=${dataDir}/ddclient.cache + foreground=YES + use=${cfg.use} + login=${cfg.username} + password=${if cfg.protocol == "nsupdate" then "/run/${RuntimeDirectory}/ddclient.key" else "@password_placeholder@"} + protocol=${cfg.protocol} + ${lib.optionalString (cfg.script != "") "script=${cfg.script}"} + ${lib.optionalString (cfg.server != "") "server=${cfg.server}"} + ${lib.optionalString (cfg.zone != "") "zone=${cfg.zone}"} + ssl=${boolToStr cfg.ssl} + wildcard=YES + quiet=${boolToStr cfg.quiet} + verbose=${boolToStr cfg.verbose} + ${cfg.extraConfig} + ${lib.concatStringsSep "," cfg.domains} + ''; + configFile = if (cfg.configFile != null) then cfg.configFile else configFile'; + + preStart = '' + install --mode=600 --owner=$USER ${configFile} /run/${RuntimeDirectory}/ddclient.conf + ${lib.optionalString (cfg.configFile == null) (if (cfg.protocol == "nsupdate") then '' + install --mode=600 --owner=$USER ${cfg.passwordFile} /run/${RuntimeDirectory}/ddclient.key + '' else if (cfg.passwordFile != null) then '' + "${pkgs.replace-secret}/bin/replace-secret" "@password_placeholder@" "${cfg.passwordFile}" "/run/${RuntimeDirectory}/ddclient.conf" + '' else '' + sed -i '/^password=@password_placeholder@$/d' /run/${RuntimeDirectory}/ddclient.conf + '')} + ''; + +in + +with lib; + +{ + + imports = [ + (mkChangedOptionModule [ "services" "ddclient" "domain" ] [ "services" "ddclient" "domains" ] + (config: + let value = getAttrFromPath [ "services" "ddclient" "domain" ] config; + in optional (value != "") value)) + (mkRemovedOptionModule [ "services" "ddclient" "homeDir" ] "") + (mkRemovedOptionModule [ "services" "ddclient" "password" ] "Use services.ddclient.passwordFile instead.") + (mkRemovedOptionModule [ "services" "ddclient" "ipv6" ] "") + ]; + + ###### interface + + options = { + + services.ddclient = with lib.types; { + + enable = mkOption { + default = false; + type = bool; + description = lib.mdDoc '' + Whether to synchronise your machine's IP address with a dynamic DNS provider (e.g. dyndns.org). + ''; + }; + + package = mkOption { + type = package; + default = pkgs.ddclient; + defaultText = lib.literalExpression "pkgs.ddclient"; + description = lib.mdDoc '' + The ddclient executable package run by the service. + ''; + }; + + domains = mkOption { + default = [ "" ]; + type = listOf str; + description = lib.mdDoc '' + Domain name(s) to synchronize. + ''; + }; + + username = mkOption { + # For `nsupdate` username contains the path to the nsupdate executable + default = lib.optionalString (config.services.ddclient.protocol == "nsupdate") "${pkgs.bind.dnsutils}/bin/nsupdate"; + defaultText = ""; + type = str; + description = lib.mdDoc '' + User name. + ''; + }; + + passwordFile = mkOption { + default = null; + type = nullOr str; + description = lib.mdDoc '' + A file containing the password or a TSIG key in named format when using the nsupdate protocol. + ''; + }; + + interval = mkOption { + default = "10min"; + type = str; + description = lib.mdDoc '' + The interval at which to run the check and update. + See {command}`man 7 systemd.time` for the format. + ''; + }; + + configFile = mkOption { + default = null; + type = nullOr path; + description = lib.mdDoc '' + Path to configuration file. + When set this overrides the generated configuration from module options. + ''; + example = "/root/nixos/secrets/ddclient.conf"; + }; + + protocol = mkOption { + default = "dyndns2"; + type = str; + description = lib.mdDoc '' + Protocol to use with dynamic DNS provider (see https://sourceforge.net/p/ddclient/wiki/protocols). + ''; + }; + + server = mkOption { + default = ""; + type = str; + description = lib.mdDoc '' + Server address. + ''; + }; + + ssl = mkOption { + default = true; + type = bool; + description = lib.mdDoc '' + Whether to use SSL/TLS to connect to dynamic DNS provider. + ''; + }; + + quiet = mkOption { + default = false; + type = bool; + description = lib.mdDoc '' + Print no messages for unnecessary updates. + ''; + }; + + script = mkOption { + default = ""; + type = str; + description = lib.mdDoc '' + script as required by some providers. + ''; + }; + + use = mkOption { + default = "web, web=checkip.dyndns.com/, web-skip='Current IP Address: '"; + type = str; + description = lib.mdDoc '' + Method to determine the IP address to send to the dynamic DNS provider. + ''; + }; + + verbose = mkOption { + default = false; + type = bool; + description = lib.mdDoc '' + Print verbose information. + ''; + }; + + zone = mkOption { + default = ""; + type = str; + description = lib.mdDoc '' + zone as required by some providers. + ''; + }; + + extraConfig = mkOption { + default = ""; + type = lines; + description = lib.mdDoc '' + Extra configuration. Contents will be added verbatim to the configuration file. + + ::: {.note} + `daemon` should not be added here because it does not work great with the systemd-timer approach the service uses. + ::: + ''; + }; + }; + }; + + + ###### implementation + + config = mkIf config.services.ddclient.enable { + systemd.services.ddclient = { + description = "Dynamic DNS Client"; + wantedBy = [ "multi-user.target" ]; + after = [ "network.target" ]; + restartTriggers = optional (cfg.configFile != null) cfg.configFile; + path = lib.optional (lib.hasPrefix "if," cfg.use) pkgs.iproute2; + + serviceConfig = { + DynamicUser = true; + RuntimeDirectoryMode = "0700"; + inherit RuntimeDirectory; + inherit StateDirectory; + Type = "oneshot"; + ExecStartPre = "!${pkgs.writeShellScript "ddclient-prestart" preStart}"; + ExecStart = "${lib.getExe cfg.package} -file /run/${RuntimeDirectory}/ddclient.conf"; + }; + }; + + systemd.timers.ddclient = { + description = "Run ddclient"; + wantedBy = [ "timers.target" ]; + timerConfig = { + OnBootSec = cfg.interval; + OnUnitInactiveSec = cfg.interval; + }; + }; + }; +} diff --git a/nixos/modules/services/security/fail2ban.nix b/nixos/modules/services/security/fail2ban.nix index 7059284850a50..235f29ab8a6a2 100644 --- a/nixos/modules/services/security/fail2ban.nix +++ b/nixos/modules/services/security/fail2ban.nix @@ -103,9 +103,9 @@ in }; bantime = mkOption { - default = null; - type = types.nullOr types.str; - example = "10m"; + default = "10m"; + type = types.str; + example = "1h"; description = lib.mdDoc "Number of seconds that a host is banned."; }; diff --git a/nixos/modules/system/boot/systemd/initrd.nix b/nixos/modules/system/boot/systemd/initrd.nix index 61af2768e2959..175e757cbbb6c 100644 --- a/nixos/modules/system/boot/systemd/initrd.nix +++ b/nixos/modules/system/boot/systemd/initrd.nix @@ -358,7 +358,7 @@ in { ++ lib.optional (cfg.enableTpm2 && !(pkgs.stdenv.hostPlatform.isRiscV64 || pkgs.stdenv.hostPlatform.isArmv7)) "tpm-crb"; boot.initrd.systemd = { - initrdBin = [pkgs.bash pkgs.coreutils cfg.package.kmod cfg.package] ++ config.system.fsPackages; + initrdBin = [pkgs.bash pkgs.coreutils cfg.package.kmod cfg.package]; extraBin = { less = "${pkgs.less}/bin/less"; mount = "${cfg.package.util-linux}/bin/mount"; diff --git a/nixos/modules/tasks/filesystems/btrfs.nix b/nixos/modules/tasks/filesystems/btrfs.nix index 82fdd60587106..87fe326c09740 100644 --- a/nixos/modules/tasks/filesystems/btrfs.nix +++ b/nixos/modules/tasks/filesystems/btrfs.nix @@ -52,34 +52,37 @@ in config = mkMerge [ (mkIf enableBtrfs { system.fsPackages = [ pkgs.btrfs-progs ]; + }) - boot.initrd.kernelModules = mkIf inInitrd [ "btrfs" ]; - boot.initrd.availableKernelModules = mkIf inInitrd ( + (mkIf inInitrd { + boot.initrd.kernelModules = [ "btrfs" ]; + boot.initrd.availableKernelModules = [ "crc32c" ] ++ optionals (config.boot.kernelPackages.kernel.kernelAtLeast "5.5") [ # Needed for mounting filesystems with new checksums "xxhash_generic" "blake2b_generic" "sha256_generic" # Should be baked into our kernel, just to be sure - ] - ); + ]; - boot.initrd.extraUtilsCommands = mkIf (inInitrd && !config.boot.initrd.systemd.enable) + boot.initrd.extraUtilsCommands = mkIf (!config.boot.initrd.systemd.enable) '' copy_bin_and_libs ${pkgs.btrfs-progs}/bin/btrfs ln -sv btrfs $out/bin/btrfsck ln -sv btrfsck $out/bin/fsck.btrfs ''; - boot.initrd.extraUtilsCommandsTest = mkIf (inInitrd && !config.boot.initrd.systemd.enable) + boot.initrd.extraUtilsCommandsTest = mkIf (!config.boot.initrd.systemd.enable) '' $out/bin/btrfs --version ''; - boot.initrd.postDeviceCommands = mkIf (inInitrd && !config.boot.initrd.systemd.enable) + boot.initrd.postDeviceCommands = mkIf (!config.boot.initrd.systemd.enable) '' btrfs device scan ''; + + boot.initrd.systemd.initrdBin = [ pkgs.btrfs-progs ]; }) (mkIf enableAutoScrub { diff --git a/nixos/modules/tasks/filesystems/cifs.nix b/nixos/modules/tasks/filesystems/cifs.nix index 0de292a692082..837b9e19bfb9d 100644 --- a/nixos/modules/tasks/filesystems/cifs.nix +++ b/nixos/modules/tasks/filesystems/cifs.nix @@ -21,5 +21,7 @@ in copy_bin_and_libs ${pkgs.cifs-utils}/sbin/mount.cifs ''; + boot.initrd.systemd.extraBin."mount.cifs" = mkIf inInitrd "${pkgs.cifs-utils}/sbin/mount.cifs"; + }; } diff --git a/nixos/modules/tasks/filesystems/ext.nix b/nixos/modules/tasks/filesystems/ext.nix index edc0efc552136..1c34ee2c70356 100644 --- a/nixos/modules/tasks/filesystems/ext.nix +++ b/nixos/modules/tasks/filesystems/ext.nix @@ -25,5 +25,7 @@ in ln -sv e2fsck $out/bin/fsck.ext4 ''; + boot.initrd.systemd.initrdBin = lib.mkIf inInitrd [ pkgs.e2fsprogs ]; + }; } diff --git a/nixos/modules/tasks/filesystems/f2fs.nix b/nixos/modules/tasks/filesystems/f2fs.nix index 035784f43df83..4f99f9a57fa6d 100644 --- a/nixos/modules/tasks/filesystems/f2fs.nix +++ b/nixos/modules/tasks/filesystems/f2fs.nix @@ -16,5 +16,7 @@ in boot.initrd.extraUtilsCommands = mkIf (inInitrd && !config.boot.initrd.systemd.enable) '' copy_bin_and_libs ${pkgs.f2fs-tools}/sbin/fsck.f2fs ''; + + boot.initrd.systemd.initrdBin = mkIf inInitrd [ pkgs.f2fs-tools ]; }; } diff --git a/nixos/modules/tasks/filesystems/jfs.nix b/nixos/modules/tasks/filesystems/jfs.nix index 6d80c4c657da6..b5132b4caa334 100644 --- a/nixos/modules/tasks/filesystems/jfs.nix +++ b/nixos/modules/tasks/filesystems/jfs.nix @@ -15,5 +15,7 @@ in boot.initrd.extraUtilsCommands = mkIf (inInitrd && !config.boot.initrd.systemd.enable) '' copy_bin_and_libs ${pkgs.jfsutils}/sbin/fsck.jfs ''; + + boot.initrd.systemd.initrdBin = mkIf inInitrd [ pkgs.jfsutils ]; }; } diff --git a/nixos/modules/tasks/filesystems/reiserfs.nix b/nixos/modules/tasks/filesystems/reiserfs.nix index 7b017a83db848..3c6a0f0cd917f 100644 --- a/nixos/modules/tasks/filesystems/reiserfs.nix +++ b/nixos/modules/tasks/filesystems/reiserfs.nix @@ -21,5 +21,7 @@ in ln -s reiserfsck $out/bin/fsck.reiserfs ''; + boot.initrd.systemd.initrdBin = mkIf inInitrd [ pkgs.reiserfsprogs ]; + }; } diff --git a/nixos/modules/tasks/filesystems/vfat.nix b/nixos/modules/tasks/filesystems/vfat.nix index 5421b617b43b9..e535e97759b22 100644 --- a/nixos/modules/tasks/filesystems/vfat.nix +++ b/nixos/modules/tasks/filesystems/vfat.nix @@ -21,5 +21,7 @@ in ln -sv dosfsck $out/bin/fsck.vfat ''; + boot.initrd.systemd.extraBin = mkIf inInitrd [ pkgs.dosfstools ]; + }; } diff --git a/nixos/modules/tasks/filesystems/xfs.nix b/nixos/modules/tasks/filesystems/xfs.nix index f81f586465519..76f31e660ad3d 100644 --- a/nixos/modules/tasks/filesystems/xfs.nix +++ b/nixos/modules/tasks/filesystems/xfs.nix @@ -26,5 +26,7 @@ in '' sed -i -e 's,^#!.*,#!'$out/bin/sh, $out/bin/fsck.xfs ''; + + boot.initrd.systemd.initrdBin = mkIf inInitrd [ pkgs.xfsprogs.bin ]; }; } diff --git a/nixos/modules/tasks/filesystems/zfs.nix b/nixos/modules/tasks/filesystems/zfs.nix index 5cf863c87f27c..7e7811fd3339b 100644 --- a/nixos/modules/tasks/filesystems/zfs.nix +++ b/nixos/modules/tasks/filesystems/zfs.nix @@ -632,7 +632,8 @@ in targets.zfs-import.wantedBy = [ "zfs.target" ]; targets.zfs.wantedBy = [ "initrd.target" ]; extraBin = { - # zpool and zfs are already in thanks to fsPackages + zpool = "${cfgZfs.package}/sbin/zpool"; + zfs = "${cfgZfs.package}/sbin/zfs"; awk = "${pkgs.gawk}/bin/awk"; }; }; diff --git a/pkgs/applications/audio/soundwireserver/default.nix b/pkgs/applications/audio/soundwireserver/default.nix index b296ebdad602a..b296ebdad602a 100755..100644 --- a/pkgs/applications/audio/soundwireserver/default.nix +++ b/pkgs/applications/audio/soundwireserver/default.nix diff --git a/pkgs/applications/blockchains/snarkos/default.nix b/pkgs/applications/blockchains/snarkos/default.nix index 080cc4b5c108f..000c1ace4a4ce 100644 --- a/pkgs/applications/blockchains/snarkos/default.nix +++ b/pkgs/applications/blockchains/snarkos/default.nix @@ -10,16 +10,16 @@ }: rustPlatform.buildRustPackage rec { pname = "snarkos"; - version = "2.1.7"; + version = "2.2.1"; src = fetchFromGitHub { owner = "AleoHQ"; repo = "snarkOS"; rev = "v${version}"; - sha256 = "sha256-kW41SNbl2vckgUth+BZ6/aM03aT6MFeY4Hwi9OVWtTI="; + sha256 = "sha256-vEoEnjVjxVnjZ3Lya1qO2kOypNu07aYSlrSya5NJZzs="; }; - cargoHash = "sha256-znEAb4q9H0Doc+XYCf27hV/z2t74kjQUffl/aJzW6tI="; + cargoHash = "sha256-CVHvBqfcTqWBtLFcEcs9y/LmQ4gXjX+dfqqZSxN+33A="; # buildAndTestSubdir = "cli"; diff --git a/pkgs/applications/editors/jetbrains/plugins/plugins.json b/pkgs/applications/editors/jetbrains/plugins/plugins.json index d93a243b0a375..353d4a5d4b0b8 100644 --- a/pkgs/applications/editors/jetbrains/plugins/plugins.json +++ b/pkgs/applications/editors/jetbrains/plugins/plugins.json @@ -22,10 +22,10 @@ "232.10072.21": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip", "232.10072.27": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip", "232.10072.28": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip", + "232.10072.31": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip", + "232.10072.32": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip", "232.9921.42": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip", - "232.9921.55": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip", "232.9921.83": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip", - "232.9921.89": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip", "233.8264.22": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip" }, "name": "ideavim" @@ -61,10 +61,10 @@ "232.10072.21": null, "232.10072.27": null, "232.10072.28": null, + "232.10072.31": null, + "232.10072.32": null, "232.9921.42": null, - "232.9921.55": null, "232.9921.83": null, - "232.9921.89": null, "233.8264.22": null }, "name": "kotlin" @@ -87,14 +87,14 @@ ], "builds": { "223.8836.1185": null, - "232.10072.15": "https://plugins.jetbrains.com/files/6981/407868/ini-232.9921.89.zip", - "232.10072.21": "https://plugins.jetbrains.com/files/6981/407868/ini-232.9921.89.zip", - "232.10072.27": "https://plugins.jetbrains.com/files/6981/407868/ini-232.9921.89.zip", - "232.10072.28": "https://plugins.jetbrains.com/files/6981/407868/ini-232.9921.89.zip", + "232.10072.15": "https://plugins.jetbrains.com/files/6981/418297/ini-232.10072.32.zip", + "232.10072.21": "https://plugins.jetbrains.com/files/6981/418297/ini-232.10072.32.zip", + "232.10072.27": "https://plugins.jetbrains.com/files/6981/418297/ini-232.10072.32.zip", + "232.10072.28": "https://plugins.jetbrains.com/files/6981/418297/ini-232.10072.32.zip", + "232.10072.31": "https://plugins.jetbrains.com/files/6981/418297/ini-232.10072.32.zip", + "232.10072.32": "https://plugins.jetbrains.com/files/6981/418297/ini-232.10072.32.zip", "232.9921.42": "https://plugins.jetbrains.com/files/6981/407868/ini-232.9921.89.zip", - "232.9921.55": "https://plugins.jetbrains.com/files/6981/407868/ini-232.9921.89.zip", "232.9921.83": "https://plugins.jetbrains.com/files/6981/407868/ini-232.9921.89.zip", - "232.9921.89": "https://plugins.jetbrains.com/files/6981/407868/ini-232.9921.89.zip", "233.8264.22": "https://plugins.jetbrains.com/files/6981/407738/ini-233.8264.9.zip" }, "name": "ini" @@ -105,8 +105,8 @@ "phpstorm" ], "builds": { - "232.10072.27": "https://plugins.jetbrains.com/files/7219/408569/Symfony_Plugin-2022.1.258.zip", - "232.9921.55": "https://plugins.jetbrains.com/files/7219/408569/Symfony_Plugin-2022.1.258.zip" + "232.10072.27": "https://plugins.jetbrains.com/files/7219/419684/Symfony_Plugin-2022.1.259.zip", + "232.10072.32": "https://plugins.jetbrains.com/files/7219/419684/Symfony_Plugin-2022.1.259.zip" }, "name": "symfony-support" }, @@ -117,7 +117,7 @@ ], "builds": { "232.10072.27": "https://plugins.jetbrains.com/files/7320/346181/PHP_Annotations-9.4.0.zip", - "232.9921.55": "https://plugins.jetbrains.com/files/7320/346181/PHP_Annotations-9.4.0.zip" + "232.10072.32": "https://plugins.jetbrains.com/files/7320/346181/PHP_Annotations-9.4.0.zip" }, "name": "php-annotations" }, @@ -158,10 +158,10 @@ "232.10072.21": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip", "232.10072.27": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip", "232.10072.28": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip", + "232.10072.31": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip", + "232.10072.32": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip", "232.9921.42": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip", - "232.9921.55": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip", - "232.9921.83": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip", - "232.9921.89": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip" + "232.9921.83": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip" }, "name": "-deprecated-rust" }, @@ -186,10 +186,10 @@ "232.10072.21": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip", "232.10072.27": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip", "232.10072.28": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip", + "232.10072.31": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip", + "232.10072.32": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip", "232.9921.42": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip", - "232.9921.55": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip", - "232.9921.83": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip", - "232.9921.89": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip" + "232.9921.83": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip" }, "name": "-deprecated-rust-beta" }, @@ -207,7 +207,7 @@ "232.10072.21": "https://plugins.jetbrains.com/files/8554/374977/featuresTrainer-232.9559.6.zip", "232.10072.27": "https://plugins.jetbrains.com/files/8554/374977/featuresTrainer-232.9559.6.zip", "232.10072.28": "https://plugins.jetbrains.com/files/8554/374977/featuresTrainer-232.9559.6.zip", - "232.9921.89": "https://plugins.jetbrains.com/files/8554/374977/featuresTrainer-232.9559.6.zip" + "232.10072.31": "https://plugins.jetbrains.com/files/8554/374977/featuresTrainer-232.9559.6.zip" }, "name": "ide-features-trainer" }, @@ -233,10 +233,10 @@ "232.10072.21": "https://plugins.jetbrains.com/files/8607/370632/NixIDEA-0.4.0.10.zip", "232.10072.27": "https://plugins.jetbrains.com/files/8607/370632/NixIDEA-0.4.0.10.zip", "232.10072.28": "https://plugins.jetbrains.com/files/8607/370632/NixIDEA-0.4.0.10.zip", + "232.10072.31": "https://plugins.jetbrains.com/files/8607/370632/NixIDEA-0.4.0.10.zip", + "232.10072.32": "https://plugins.jetbrains.com/files/8607/370632/NixIDEA-0.4.0.10.zip", "232.9921.42": "https://plugins.jetbrains.com/files/8607/370632/NixIDEA-0.4.0.10.zip", - "232.9921.55": "https://plugins.jetbrains.com/files/8607/370632/NixIDEA-0.4.0.10.zip", "232.9921.83": "https://plugins.jetbrains.com/files/8607/370632/NixIDEA-0.4.0.10.zip", - "232.9921.89": "https://plugins.jetbrains.com/files/8607/370632/NixIDEA-0.4.0.10.zip", "233.8264.22": null }, "name": "nixidea" @@ -267,16 +267,16 @@ "webstorm" ], "builds": { - "223.8836.1185": "https://plugins.jetbrains.com/files/10037/358812/CSVEditor-3.2.1-223.zip", - "232.10072.15": "https://plugins.jetbrains.com/files/10037/358813/CSVEditor-3.2.1-232.zip", - "232.10072.21": "https://plugins.jetbrains.com/files/10037/358813/CSVEditor-3.2.1-232.zip", - "232.10072.27": "https://plugins.jetbrains.com/files/10037/358813/CSVEditor-3.2.1-232.zip", - "232.10072.28": "https://plugins.jetbrains.com/files/10037/358813/CSVEditor-3.2.1-232.zip", - "232.9921.42": "https://plugins.jetbrains.com/files/10037/358813/CSVEditor-3.2.1-232.zip", - "232.9921.55": "https://plugins.jetbrains.com/files/10037/358813/CSVEditor-3.2.1-232.zip", - "232.9921.83": "https://plugins.jetbrains.com/files/10037/358813/CSVEditor-3.2.1-232.zip", - "232.9921.89": "https://plugins.jetbrains.com/files/10037/358813/CSVEditor-3.2.1-232.zip", - "233.8264.22": "https://plugins.jetbrains.com/files/10037/243092/CSV-2.21.0.zip" + "223.8836.1185": "https://plugins.jetbrains.com/files/10037/417700/CSVEditor-3.2.2-223.zip", + "232.10072.15": "https://plugins.jetbrains.com/files/10037/417699/CSVEditor-3.2.2-232.zip", + "232.10072.21": "https://plugins.jetbrains.com/files/10037/417699/CSVEditor-3.2.2-232.zip", + "232.10072.27": "https://plugins.jetbrains.com/files/10037/417699/CSVEditor-3.2.2-232.zip", + "232.10072.28": "https://plugins.jetbrains.com/files/10037/417699/CSVEditor-3.2.2-232.zip", + "232.10072.31": "https://plugins.jetbrains.com/files/10037/417699/CSVEditor-3.2.2-232.zip", + "232.10072.32": "https://plugins.jetbrains.com/files/10037/417699/CSVEditor-3.2.2-232.zip", + "232.9921.42": "https://plugins.jetbrains.com/files/10037/417699/CSVEditor-3.2.2-232.zip", + "232.9921.83": "https://plugins.jetbrains.com/files/10037/417699/CSVEditor-3.2.2-232.zip", + "233.8264.22": "https://plugins.jetbrains.com/files/10037/417702/CSVEditor-3.2.2-233.zip" }, "name": "csv-editor" }, @@ -302,10 +302,10 @@ "232.10072.21": "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip", "232.10072.27": "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip", "232.10072.28": "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip", + "232.10072.31": "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip", + "232.10072.32": "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip", "232.9921.42": "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip", - "232.9921.55": "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip", "232.9921.83": "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip", - "232.9921.89": "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip", "233.8264.22": "https://plugins.jetbrains.com/files/12062/405118/keymap-vscode-233.8264.3.zip" }, "name": "vscode-keymap" @@ -332,10 +332,10 @@ "232.10072.21": "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip", "232.10072.27": "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip", "232.10072.28": "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip", + "232.10072.31": "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip", + "232.10072.32": "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip", "232.9921.42": "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip", - "232.9921.55": "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip", "232.9921.83": "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip", - "232.9921.89": "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip", "233.8264.22": "https://plugins.jetbrains.com/files/12559/405631/keymap-eclipse-233.8264.9.zip" }, "name": "eclipse-keymap" @@ -362,10 +362,10 @@ "232.10072.21": "https://plugins.jetbrains.com/files/13017/364038/keymap-visualStudio-232.8660.88.zip", "232.10072.27": "https://plugins.jetbrains.com/files/13017/364038/keymap-visualStudio-232.8660.88.zip", "232.10072.28": "https://plugins.jetbrains.com/files/13017/364038/keymap-visualStudio-232.8660.88.zip", + "232.10072.31": "https://plugins.jetbrains.com/files/13017/364038/keymap-visualStudio-232.8660.88.zip", + "232.10072.32": "https://plugins.jetbrains.com/files/13017/364038/keymap-visualStudio-232.8660.88.zip", "232.9921.42": "https://plugins.jetbrains.com/files/13017/364038/keymap-visualStudio-232.8660.88.zip", - "232.9921.55": "https://plugins.jetbrains.com/files/13017/364038/keymap-visualStudio-232.8660.88.zip", "232.9921.83": "https://plugins.jetbrains.com/files/13017/364038/keymap-visualStudio-232.8660.88.zip", - "232.9921.89": "https://plugins.jetbrains.com/files/13017/364038/keymap-visualStudio-232.8660.88.zip", "233.8264.22": "https://plugins.jetbrains.com/files/13017/405636/keymap-visualStudio-233.8264.9.zip" }, "name": "visual-studio-keymap" @@ -392,10 +392,10 @@ "232.10072.21": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar", "232.10072.27": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar", "232.10072.28": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar", + "232.10072.31": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar", + "232.10072.32": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar", "232.9921.42": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar", - "232.9921.55": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar", "232.9921.83": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar", - "232.9921.89": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar", "233.8264.22": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar" }, "name": "darcula-pitch-black" @@ -422,10 +422,10 @@ "232.10072.21": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip", "232.10072.27": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip", "232.10072.28": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip", + "232.10072.31": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip", + "232.10072.32": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip", "232.9921.42": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip", - "232.9921.55": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip", "232.9921.83": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip", - "232.9921.89": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip", "233.8264.22": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip" }, "name": "github-copilot" @@ -452,10 +452,10 @@ "232.10072.21": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip", "232.10072.27": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip", "232.10072.28": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip", + "232.10072.31": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip", + "232.10072.32": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip", "232.9921.42": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip", - "232.9921.55": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip", "232.9921.83": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip", - "232.9921.89": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip", "233.8264.22": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip" }, "name": "netbeans-6-5-keymap" @@ -475,9 +475,9 @@ } }, "files": { - "https://plugins.jetbrains.com/files/10037/243092/CSV-2.21.0.zip": "sha256-Mfo8z2pjn+Gk1uumw5xpZQwpkqLRVqAu2Z07zjn2N1M=", - "https://plugins.jetbrains.com/files/10037/358812/CSVEditor-3.2.1-223.zip": "sha256-l8xq7XXQheZYcP+kdnLXAO7FhfPJYwIh+ZffbttBI9s=", - "https://plugins.jetbrains.com/files/10037/358813/CSVEditor-3.2.1-232.zip": "sha256-m9ocJSFWparZLrX1MQA0IlSH5LHodmzzVmGZ6eHml24=", + "https://plugins.jetbrains.com/files/10037/417699/CSVEditor-3.2.2-232.zip": "sha256-3bHSRhzvVO07mvuD6tpkiKFXTF66zCK/wpXFVb8IkfY=", + "https://plugins.jetbrains.com/files/10037/417700/CSVEditor-3.2.2-223.zip": "sha256-4Y/DZpCWKljaslJFsaqItq1DVJVVRlQjWpM6GLRo8QA=", + "https://plugins.jetbrains.com/files/10037/417702/CSVEditor-3.2.2-233.zip": "sha256-n4psF9fFFU8ohtbOndRx6i20EntjEzL3BvMObAZyOOw=", "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip": "sha256-q5i1eAANK+6uBYrtioKLzvJf5ALUB0K4d31Ut0vT/lE=", "https://plugins.jetbrains.com/files/12062/405118/keymap-vscode-233.8264.3.zip": "sha256-cB3DTeWhDgAwHlxwYogd0/DuYBzo5DqaRtBvEC/p8I4=", "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip": "sha256-eRCsivZbDNrc+kesa9jVsOoMFFz+WpYfSMXxPCCjWjw=", @@ -495,7 +495,8 @@ "https://plugins.jetbrains.com/files/6954/381727/kotlin-plugin-223-1.9.10-release-459-IJ8836.35.zip": "sha256-gHkNQyWh6jtY1986aI7Qo6ZNrniPy+Yq4XLLA0pKJkA=", "https://plugins.jetbrains.com/files/6981/407738/ini-233.8264.9.zip": "sha256-E3xWjwTxtLkOtm9748BbkKGaS4l8SlZOkj3w6VgqlFQ=", "https://plugins.jetbrains.com/files/6981/407868/ini-232.9921.89.zip": "sha256-XIdhTQMxl/nJnntfQlHLlcyA79IS3hnGEGrXhKBFgY0=", - "https://plugins.jetbrains.com/files/7219/408569/Symfony_Plugin-2022.1.258.zip": "sha256-O4ARifSoeL5kXnFQTs6YoLcJvdg5VHks5LIgnwwUAeQ=", + "https://plugins.jetbrains.com/files/6981/418297/ini-232.10072.32.zip": "sha256-eC5Zs6ph/4C3Xf6e07DfyqhBmsG3bAFLnvae1JiFzpE=", + "https://plugins.jetbrains.com/files/7219/419684/Symfony_Plugin-2022.1.259.zip": "sha256-3UxSPvEXXhAf3zYg2H/jja4F5fuDFWQ6SWFRvcWJ0Iw=", "https://plugins.jetbrains.com/files/7320/346181/PHP_Annotations-9.4.0.zip": "sha256-hT5K4w4lhvNwDzDMDSvsIDGj9lyaRqglfOhlbNdqpWs=", "https://plugins.jetbrains.com/files/7322/401058/python-ce-232.9921.77.zip": "sha256-cr4LxSz8xVzC+Zm+6LnWGLbF6aGBVLW56crCIQOawhc=", "https://plugins.jetbrains.com/files/7322/405773/python-ce-233.8264.8.zip": "sha256-LjN0BkcnX8mVHh2dPULddVwooi9fcABkrRVhTPA7XSo=", diff --git a/pkgs/applications/editors/jetbrains/versions.json b/pkgs/applications/editors/jetbrains/versions.json index c95feebdb674a..5bbbd9dfc7b66 100644 --- a/pkgs/applications/editors/jetbrains/versions.json +++ b/pkgs/applications/editors/jetbrains/versions.json @@ -67,27 +67,27 @@ "phpstorm": { "update-channel": "PhpStorm RELEASE", "url-template": "https://download.jetbrains.com/webide/PhpStorm-{version}.tar.gz", - "version": "2023.2.2", - "sha256": "5e3dd021b82dcad0f51bded677aa87680dcc3f5d843951c48848a9191141bf1d", - "url": "https://download.jetbrains.com/webide/PhpStorm-2023.2.2.tar.gz", - "build_number": "232.9921.55", + "version": "2023.2.3", + "sha256": "dd8d771508b277ab2a713b8f546c2ec6dbb261ba8c23072e46ec6ce2ea9ab2a0", + "url": "https://download.jetbrains.com/webide/PhpStorm-2023.2.3.tar.gz", + "build_number": "232.10072.32", "version-major-minor": "2022.3" }, "pycharm-community": { "update-channel": "PyCharm RELEASE", "url-template": "https://download.jetbrains.com/python/pycharm-community-{version}.tar.gz", - "version": "2023.2.2", - "sha256": "2bb4f73d041b818a7b631feb3fee77036de764543c669efe9cf6766510a68e3f", - "url": "https://download.jetbrains.com/python/pycharm-community-2023.2.2.tar.gz", - "build_number": "232.9921.89" + "version": "2023.2.3", + "sha256": "d59dd88c1eb51cdd756433d415588c573ca944ebf6f08844b8ac8cd2e3d9937b", + "url": "https://download.jetbrains.com/python/pycharm-community-2023.2.3.tar.gz", + "build_number": "232.10072.31" }, "pycharm-professional": { "update-channel": "PyCharm RELEASE", "url-template": "https://download.jetbrains.com/python/pycharm-professional-{version}.tar.gz", - "version": "2023.2.2", - "sha256": "f7263b17e2456efcb5efab1eac53aafb6a0be1a7f9fbf25a419c9d7b447f6ded", - "url": "https://download.jetbrains.com/python/pycharm-professional-2023.2.2.tar.gz", - "build_number": "232.9921.89" + "version": "2023.2.3", + "sha256": "e625fea80b72c9e12f986a8eb918425c6ef1d3f7b31117b40d122e3ce76046b1", + "url": "https://download.jetbrains.com/python/pycharm-professional-2023.2.3.tar.gz", + "build_number": "232.10072.31" }, "rider": { "update-channel": "Rider RELEASE", @@ -190,27 +190,27 @@ "phpstorm": { "update-channel": "PhpStorm RELEASE", "url-template": "https://download.jetbrains.com/webide/PhpStorm-{version}-aarch64.tar.gz", - "version": "2023.2.2", - "sha256": "b3067ffa32fab0880ffce8dff000d463b86bef9b30f53fc4d41f5d4e518c7528", - "url": "https://download.jetbrains.com/webide/PhpStorm-2023.2.2-aarch64.tar.gz", - "build_number": "232.9921.55", + "version": "2023.2.3", + "sha256": "577bea15c1208e0b842bcdb2ff0f0205144a8800fcadf87f873af7c067e0ce73", + "url": "https://download.jetbrains.com/webide/PhpStorm-2023.2.3-aarch64.tar.gz", + "build_number": "232.10072.32", "version-major-minor": "2022.3" }, "pycharm-community": { "update-channel": "PyCharm RELEASE", "url-template": "https://download.jetbrains.com/python/pycharm-community-{version}-aarch64.tar.gz", - "version": "2023.2.2", - "sha256": "7d15908f9261ee7905b61d83d4a048fee1e3a2fea9465ada1fc459b2ea0e4d5f", - "url": "https://download.jetbrains.com/python/pycharm-community-2023.2.2-aarch64.tar.gz", - "build_number": "232.9921.89" + "version": "2023.2.3", + "sha256": "6fdc5238ffa4767834b11b52b650107f1c64d6a53d0e2bbc23581b6c90b67ab5", + "url": "https://download.jetbrains.com/python/pycharm-community-2023.2.3-aarch64.tar.gz", + "build_number": "232.10072.31" }, "pycharm-professional": { "update-channel": "PyCharm RELEASE", "url-template": "https://download.jetbrains.com/python/pycharm-professional-{version}-aarch64.tar.gz", - "version": "2023.2.2", - "sha256": "2cf259859847f7a979565f31faa60148d571206c78c9309dcdf867b76c16ef25", - "url": "https://download.jetbrains.com/python/pycharm-professional-2023.2.2-aarch64.tar.gz", - "build_number": "232.9921.89" + "version": "2023.2.3", + "sha256": "578ecbd059ccb010682cf602e959454b296ec2e741202f236fbdb38897b296dd", + "url": "https://download.jetbrains.com/python/pycharm-professional-2023.2.3-aarch64.tar.gz", + "build_number": "232.10072.31" }, "rider": { "update-channel": "Rider RELEASE", @@ -313,27 +313,27 @@ "phpstorm": { "update-channel": "PhpStorm RELEASE", "url-template": "https://download.jetbrains.com/webide/PhpStorm-{version}.dmg", - "version": "2023.2.2", - "sha256": "99a9bb313a5c141ecd1810306deaca3cf52d338edf206362b3f9d9337a27890e", - "url": "https://download.jetbrains.com/webide/PhpStorm-2023.2.2.dmg", - "build_number": "232.9921.55", + "version": "2023.2.3", + "sha256": "7ce4ff6b344ff8ce18ef8a821ba3fd1d222f9222a9b3e65744a796379d92417e", + "url": "https://download.jetbrains.com/webide/PhpStorm-2023.2.3.dmg", + "build_number": "232.10072.32", "version-major-minor": "2022.3" }, "pycharm-community": { "update-channel": "PyCharm RELEASE", "url-template": "https://download.jetbrains.com/python/pycharm-community-{version}.dmg", - "version": "2023.2.2", - "sha256": "f482b6d451efec897764487b116f7bf09d507a5ebfb841c33e2abd2441c3b3a7", - "url": "https://download.jetbrains.com/python/pycharm-community-2023.2.2.dmg", - "build_number": "232.9921.89" + "version": "2023.2.3", + "sha256": "b914bd3c0018f951bef5da9c04907355a88546ce983dcf4115bbf11556015ec7", + "url": "https://download.jetbrains.com/python/pycharm-community-2023.2.3.dmg", + "build_number": "232.10072.31" }, "pycharm-professional": { "update-channel": "PyCharm RELEASE", "url-template": "https://download.jetbrains.com/python/pycharm-professional-{version}.dmg", - "version": "2023.2.2", - "sha256": "830f590d63199b389bbaa955c8602fa027bc1eb25bd8ce5636474eec72745b58", - "url": "https://download.jetbrains.com/python/pycharm-professional-2023.2.2.dmg", - "build_number": "232.9921.89" + "version": "2023.2.3", + "sha256": "b33bbd30222363cdc3091aee923ed1c309edba799616a3a681cd9a1ca94e822a", + "url": "https://download.jetbrains.com/python/pycharm-professional-2023.2.3.dmg", + "build_number": "232.10072.31" }, "rider": { "update-channel": "Rider RELEASE", @@ -436,27 +436,27 @@ "phpstorm": { "update-channel": "PhpStorm RELEASE", "url-template": "https://download.jetbrains.com/webide/PhpStorm-{version}-aarch64.dmg", - "version": "2023.2.2", - "sha256": "a31daeddae532324436b2d11acbd5fb657721883f17c7ef4457ac76a51bd4189", - "url": "https://download.jetbrains.com/webide/PhpStorm-2023.2.2-aarch64.dmg", - "build_number": "232.9921.55", + "version": "2023.2.3", + "sha256": "68d543fb2a79cd0b07ddb94a4c00d8c0c1aca7f604bc838ac92e232e763489b3", + "url": "https://download.jetbrains.com/webide/PhpStorm-2023.2.3-aarch64.dmg", + "build_number": "232.10072.32", "version-major-minor": "2022.3" }, "pycharm-community": { "update-channel": "PyCharm RELEASE", "url-template": "https://download.jetbrains.com/python/pycharm-community-{version}-aarch64.dmg", - "version": "2023.2.2", - "sha256": "2bcddf3e58902578745dd1803f17ebd18f4c98dc76bf48b0945afbc7bae45832", - "url": "https://download.jetbrains.com/python/pycharm-community-2023.2.2-aarch64.dmg", - "build_number": "232.9921.89" + "version": "2023.2.3", + "sha256": "08c45adbb0dca219955f511993ca8150dcca235bdba3ac24c67ae035c68ba992", + "url": "https://download.jetbrains.com/python/pycharm-community-2023.2.3-aarch64.dmg", + "build_number": "232.10072.31" }, "pycharm-professional": { "update-channel": "PyCharm RELEASE", "url-template": "https://download.jetbrains.com/python/pycharm-professional-{version}-aarch64.dmg", - "version": "2023.2.2", - "sha256": "5d4292dd0e40db35199ebcd6472d4b46c505d3357d2324690338758355e0f092", - "url": "https://download.jetbrains.com/python/pycharm-professional-2023.2.2-aarch64.dmg", - "build_number": "232.9921.89" + "version": "2023.2.3", + "sha256": "63d68b20963575f76937ca0ce18a8150639c47b8cf8f3d6e96fa3306191cd076", + "url": "https://download.jetbrains.com/python/pycharm-professional-2023.2.3-aarch64.dmg", + "build_number": "232.10072.31" }, "rider": { "update-channel": "Rider RELEASE", diff --git a/pkgs/applications/editors/neovim/neovim-gtk.nix b/pkgs/applications/editors/neovim/neovim-gtk.nix index eebb980f85cb5..eebb980f85cb5 100755..100644 --- a/pkgs/applications/editors/neovim/neovim-gtk.nix +++ b/pkgs/applications/editors/neovim/neovim-gtk.nix diff --git a/pkgs/applications/editors/pulsar/default.nix b/pkgs/applications/editors/pulsar/default.nix index d2162dc9c9ef1..ef08ac9352dde 100644 --- a/pkgs/applications/editors/pulsar/default.nix +++ b/pkgs/applications/editors/pulsar/default.nix @@ -209,5 +209,14 @@ stdenv.mkDerivation rec { license = licenses.mit; platforms = platforms.linux; maintainers = with maintainers; [ colamaroro ]; + knownVulnerabilities = [ + "CVE-2023-5217" + "CVE-2022-21718" + "CVE-2022-29247" + "CVE-2022-29257" + "CVE-2022-36077" + "CVE-2023-29198" + "CVE-2023-39956" + ]; }; } diff --git a/pkgs/applications/editors/vscode/extensions/default.nix b/pkgs/applications/editors/vscode/extensions/default.nix index c0d3415713fce..fb6e709bba202 100644 --- a/pkgs/applications/editors/vscode/extensions/default.nix +++ b/pkgs/applications/editors/vscode/extensions/default.nix @@ -326,8 +326,8 @@ let mktplcRef = { name = "astro-vscode"; publisher = "astro-build"; - version = "2.1.1"; - sha256 = "sha256-UVZOpkOHbLiwA4VfTgXxuIU8EtJLnqRa5zUVha6xQJY="; + version = "2.3.3"; + sha256 = "sha256-A7+7lnCPAtSWUfHLNKbYqKuTxi2Nx05Qdh5HCkT1dnM="; }; meta = { changelog = "https://marketplace.visualstudio.com/items/astro-build.astro-vscode/changelog"; diff --git a/pkgs/applications/emulators/yuzu/generic.nix b/pkgs/applications/emulators/yuzu/generic.nix index 3fdd6db84661a..a24ded8525310 100644 --- a/pkgs/applications/emulators/yuzu/generic.nix +++ b/pkgs/applications/emulators/yuzu/generic.nix @@ -49,10 +49,10 @@ }: let - tzinfoVersion = "220816"; + tzinfoVersion = "221202"; tzinfo = fetchurl { url = "https://github.com/lat9nq/tzdb_to_nx/releases/download/${tzinfoVersion}/${tzinfoVersion}.zip"; - hash = "sha256-yv8ykEYPu9upeXovei0u16iqQ7NasH6873KnQy4+KwI="; + hash = "sha256-mRzW+iIwrU1zsxHmf+0RArU8BShAoEMvCz+McXFFK3c="; }; in stdenv.mkDerivation { pname = "yuzu-${branch}"; diff --git a/pkgs/applications/emulators/yuzu/sources.nix b/pkgs/applications/emulators/yuzu/sources.nix index fc6d1813afb51..3371bf15c5c99 100644 --- a/pkgs/applications/emulators/yuzu/sources.nix +++ b/pkgs/applications/emulators/yuzu/sources.nix @@ -1,19 +1,19 @@ # Generated by ./update.sh - do not update manually! -# Last updated: 2023-10-07 +# Last updated: 2023-10-20 { compatList = { - rev = "156a0a80efc47069ba3360f8a1b268a1c6f2f505"; + rev = "9d17cbd71408476c6a28cbf0fa8177155c511681"; hash = "sha256:1hdsza3wf9a0yvj6h55gsl7xqvhafvbz1i8paz9kg7l49b0gnlh1"; }; mainline = { - version = "1579"; - hash = "sha256:0689w42as1di8xbh8kq2p0cws8gdwq64zdj3i8wq612nkw0q5s60"; + version = "1595"; + hash = "sha256:09b0w6z4w9z4ms2pvik2vrmklfcx25jxcgs61bff3nflilnw9m97"; }; ea = { - version = "3911"; - distHash = "sha256:0xj642kjhj0gp9l15b3ysj3gmyy47rcvzw9amghsfl13bg5ffnwh"; - fullHash = "sha256:13rd6kwnhpvjzp67k6pqgl9fsqzwy5d8043hv6kd93gg8jbxkp38"; + version = "3940"; + distHash = "sha256:0g0vv274sh3iy56n7s324km87g302005ahi9zh2qhwkiirbnc811"; + fullHash = "sha256:0ywppc4z5d4b1zl1cr8yfnba58hgi0z2szficwpinapai7q0pyid"; }; } diff --git a/pkgs/applications/graphics/structorizer/default.nix b/pkgs/applications/graphics/structorizer/default.nix index d1f796e42fee1..d1f796e42fee1 100755..100644 --- a/pkgs/applications/graphics/structorizer/default.nix +++ b/pkgs/applications/graphics/structorizer/default.nix diff --git a/pkgs/applications/misc/ArchiSteamFarm/default.nix b/pkgs/applications/misc/ArchiSteamFarm/default.nix index 60b835c719b57..1a0e90546bec7 100644 --- a/pkgs/applications/misc/ArchiSteamFarm/default.nix +++ b/pkgs/applications/misc/ArchiSteamFarm/default.nix @@ -11,13 +11,13 @@ buildDotnetModule rec { pname = "ArchiSteamFarm"; # nixpkgs-update: no auto update - version = "5.4.9.3"; + version = "5.4.12.5"; src = fetchFromGitHub { owner = "JustArchiNET"; repo = "ArchiSteamFarm"; rev = version; - hash = "sha256-Yp8hnMIeV+ZHY6yISJdFd1yAQipQsU5vcXgxFDvkGnA="; + hash = "sha256-iIYA9BnHUfsB4J7VbSLKaRdJHMW/xULJxKfv8atfAd8="; }; dotnet-runtime = dotnetCorePackages.aspnetcore_7_0; @@ -77,6 +77,7 @@ buildDotnetModule rec { homepage = "https://github.com/JustArchiNET/ArchiSteamFarm"; license = licenses.asl20; platforms = [ "x86_64-linux" "aarch64-linux" ]; + mainProgram = "ArchiSteamFarm"; maintainers = with maintainers; [ SuperSandro2000 lom ]; }; } diff --git a/pkgs/applications/misc/ArchiSteamFarm/deps.nix b/pkgs/applications/misc/ArchiSteamFarm/deps.nix index 5d353bfdf6b89..6154d1ca6e2d9 100644 --- a/pkgs/applications/misc/ArchiSteamFarm/deps.nix +++ b/pkgs/applications/misc/ArchiSteamFarm/deps.nix @@ -57,11 +57,11 @@ (fetchNuGet { pname = "Humanizer.Core.zh-Hans"; version = "2.14.1"; sha256 = "0zn99311zfn602phxyskfjq9vly0w5712z6fly8r4q0h94qa8c85"; }) (fetchNuGet { pname = "Humanizer.Core.zh-Hant"; version = "2.14.1"; sha256 = "0qxjnbdj645l5sd6y3100yyrq1jy5misswg6xcch06x8jv7zaw1p"; }) (fetchNuGet { pname = "JetBrains.Annotations"; version = "2023.2.0"; sha256 = "0nx7nrzbg9gk9skdc9x330cbr5xbsly6z9gzxm46vywf55yp8vaj"; }) - (fetchNuGet { pname = "Markdig.Signed"; version = "0.32.0"; sha256 = "0rc1d8pwypq44pr15wn8g52zbqz70swdrdmjlzccf6zvwy1vyqkc"; }) + (fetchNuGet { pname = "Markdig.Signed"; version = "0.33.0"; sha256 = "0816lmn0varxwhdklhh5hdqp0xnfz3nlrvaf2wpkk5v1mq86216h"; }) (fetchNuGet { pname = "Microsoft.AspNetCore.JsonPatch"; version = "7.0.0"; sha256 = "1f13vsfs1rp9bmdp3khk4mk2fif932d72yxm2wszpsr239x4s2bf"; }) (fetchNuGet { pname = "Microsoft.AspNetCore.Mvc.NewtonsoftJson"; version = "7.0.0"; sha256 = "1w49rg0n5wb1m5wnays2mmym7qy7bsi2b1zxz97af2rkbw3s3hbd"; }) (fetchNuGet { pname = "Microsoft.Bcl.AsyncInterfaces"; version = "6.0.0"; sha256 = "15gqy2m14fdlvy1g59207h5kisznm355kbw010gy19vh47z8gpz3"; }) - (fetchNuGet { pname = "Microsoft.CodeCoverage"; version = "17.7.0"; sha256 = "12m9fay2d7jvj00hfpws37vflpqvz4dy4gcm25bjycg1zyfpzvly"; }) + (fetchNuGet { pname = "Microsoft.CodeCoverage"; version = "17.7.2"; sha256 = "09mf5kpxn1a1m8ciwklhh6ascx0yqpcs5r2hvmfj80j44n3qrwhm"; }) (fetchNuGet { pname = "Microsoft.CSharp"; version = "4.7.0"; sha256 = "0gd67zlw554j098kabg887b5a6pq9kzavpa3jjy5w53ccjzjfy8j"; }) (fetchNuGet { pname = "Microsoft.Extensions.ApiDescription.Server"; version = "6.0.5"; sha256 = "1pi2bm3cm0a7jzqzmfc2r7bpcdkmk3hhjfvb2c81j7wl7xdw3624"; }) (fetchNuGet { pname = "Microsoft.Extensions.Configuration.Abstractions"; version = "6.0.0"; sha256 = "0w6wwxv12nbc3sghvr68847wc9skkdgsicrz3fx4chgng1i3xy0j"; }) @@ -71,11 +71,15 @@ (fetchNuGet { pname = "Microsoft.Extensions.Logging.Abstractions"; version = "6.0.0"; sha256 = "0b75fmins171zi6bfdcq1kcvyrirs8n91mknjnxy4c3ygi1rrnj0"; }) (fetchNuGet { pname = "Microsoft.Extensions.Options"; version = "6.0.0"; sha256 = "008pnk2p50i594ahz308v81a41mbjz9mwcarqhmrjpl2d20c868g"; }) (fetchNuGet { pname = "Microsoft.Extensions.Primitives"; version = "6.0.0"; sha256 = "1kjiw6s4yfz9gm7mx3wkhp06ghnbs95icj9hi505shz9rjrg42q2"; }) - (fetchNuGet { pname = "Microsoft.NET.Test.Sdk"; version = "17.7.0"; sha256 = "1srhqqmnf9pxdbpffr7dh0bihhf09d0iq5g6gh8ql7brfrh99lvb"; }) + (fetchNuGet { pname = "Microsoft.IdentityModel.Abstractions"; version = "7.0.3"; sha256 = "0njmg2lygnirnfjv9gck2f5lq4ly5rgws9cpf8qj3kwcwxfp0b9s"; }) + (fetchNuGet { pname = "Microsoft.IdentityModel.JsonWebTokens"; version = "7.0.3"; sha256 = "1ayh85xqdq8rqjk2iqcn7iaczcl7d8qg6bxk0b4rgx59fmsmbqj7"; }) + (fetchNuGet { pname = "Microsoft.IdentityModel.Logging"; version = "7.0.3"; sha256 = "13cjqmf59k895q6gkd5ycl89mnpalckda7rhsdl11jdyr32hsfnv"; }) + (fetchNuGet { pname = "Microsoft.IdentityModel.Tokens"; version = "7.0.3"; sha256 = "1pmhd0imh9wlhvbvvwjrpjsqvzagi2ly22nddwr4r0pi234khyz1"; }) + (fetchNuGet { pname = "Microsoft.NET.Test.Sdk"; version = "17.7.2"; sha256 = "08g9dpp766racnh90s1sy3ncl291majgq6v2604hfw1f6zkmbjqh"; }) (fetchNuGet { pname = "Microsoft.NETCore.Platforms"; version = "5.0.0"; sha256 = "0mwpwdflidzgzfx2dlpkvvnkgkr2ayaf0s80737h4wa35gaj11rc"; }) (fetchNuGet { pname = "Microsoft.OpenApi"; version = "1.2.3"; sha256 = "07b19k89whj69j87afkz86gp9b3iybw8jqwvlgcn43m7fb2y99rr"; }) - (fetchNuGet { pname = "Microsoft.TestPlatform.ObjectModel"; version = "17.7.0"; sha256 = "1sqmk99644fx66zk2qa2ims1zl6741i3wl4rjh4z6jakd4xbc28i"; }) - (fetchNuGet { pname = "Microsoft.TestPlatform.TestHost"; version = "17.7.0"; sha256 = "1s8ap0ljqssbqp1ilgsidjr948b9szf1cbl3fgl6smxig9im4zrl"; }) + (fetchNuGet { pname = "Microsoft.TestPlatform.ObjectModel"; version = "17.7.2"; sha256 = "0xdjkdnrvnaxqgg38y5w1l3jbppigg68cc8q9jn0p21vn48bgrxq"; }) + (fetchNuGet { pname = "Microsoft.TestPlatform.TestHost"; version = "17.7.2"; sha256 = "1szsg1iy77f0caxzkk0ihpp4ifbfnbdbn8k0wbbhbdprxj8pr356"; }) (fetchNuGet { pname = "Microsoft.Win32.Registry"; version = "5.0.0"; sha256 = "102hvhq2gmlcbq8y2cb7hdr2dnmjzfp2k3asr1ycwrfacwyaak7n"; }) (fetchNuGet { pname = "MSTest.TestAdapter"; version = "3.1.1"; sha256 = "0y3ic8jv5jhld6gan2qfa2wyk4z57f7y4y5a47njr0jvxxnarg2c"; }) (fetchNuGet { pname = "MSTest.TestFramework"; version = "3.1.1"; sha256 = "1lbgkrbrkmw4c54g61cwbmwc4zl8hyqmp283ymvj93lq7chbxasn"; }) @@ -86,9 +90,9 @@ (fetchNuGet { pname = "Nito.AsyncEx.Tasks"; version = "5.1.2"; sha256 = "11wp47kc69sjdxrbg5pgx0wlffqlp0x5kr54ggnz2v19kmjz362v"; }) (fetchNuGet { pname = "Nito.Collections.Deque"; version = "1.1.1"; sha256 = "152564q3s0n5swfv5p5rx0ghn2sm0g2xsnbd7gv8vb9yfklv7yg8"; }) (fetchNuGet { pname = "Nito.Disposables"; version = "2.2.1"; sha256 = "1hx5k8497j34kxxgh060bvij0vfnraw90dmm3h9bmamcdi8wp80l"; }) - (fetchNuGet { pname = "NLog"; version = "5.2.3"; sha256 = "0srai3s2kk9y2jimdvw1xw86nch38q6nza598dpr81dghx3s6j6w"; }) - (fetchNuGet { pname = "NLog.Extensions.Logging"; version = "5.3.3"; sha256 = "0j19fljxbcc0bysmj7i0fmiax6sp5kjapf2llkimv7dh63rj9ckg"; }) - (fetchNuGet { pname = "NLog.Web.AspNetCore"; version = "5.3.3"; sha256 = "0rhha2lwrzwlx0q1a8w9ph9xwayl3kmmy200ygsghcd02srlazkj"; }) + (fetchNuGet { pname = "NLog"; version = "5.2.5"; sha256 = "02fybqi9d7czz3jmhmgb8wia2hpjj5hmcnij6zsgs69rkv6hf9j0"; }) + (fetchNuGet { pname = "NLog.Extensions.Logging"; version = "5.3.5"; sha256 = "0jzfqa12l5vvxd2j684cnm29w19v386cpm11pw8h6prpf57affaj"; }) + (fetchNuGet { pname = "NLog.Web.AspNetCore"; version = "5.3.5"; sha256 = "0li0sw04w0a4zms5jjv1ga45wxiqlcvaw8gi0wbhiifrdzz5yckb"; }) (fetchNuGet { pname = "NuGet.Frameworks"; version = "6.5.0"; sha256 = "0s37d1p4md0k6d4cy6sq36f2dgkd9qfbzapxhkvi8awwh0vrynhj"; }) (fetchNuGet { pname = "protobuf-net"; version = "3.2.16"; sha256 = "0pwlqlq2p8my2sr8b0cvdav5cm8wpwf3s4gy7s1ba701ac2zyb9y"; }) (fetchNuGet { pname = "protobuf-net.Core"; version = "3.2.16"; sha256 = "00znhikq7valr3jaxg66cwli9hf75wkmmpf6rf8p790hf8lxq0c5"; }) @@ -108,6 +112,7 @@ (fetchNuGet { pname = "System.Composition.Runtime"; version = "7.0.0"; sha256 = "1p9xpqzx42s8cdizv6nh15hcjvl2km0rwby66nfkj4cb472l339s"; }) (fetchNuGet { pname = "System.Composition.TypedParts"; version = "7.0.0"; sha256 = "0syz7y6wgnxxgjvfqgymn9mnaa5fjy1qp06qnsvh3agr9mvcv779"; }) (fetchNuGet { pname = "System.Diagnostics.DiagnosticSource"; version = "6.0.0"; sha256 = "0rrihs9lnb1h6x4h0hn6kgfnh58qq7hx8qq99gh6fayx4dcnx3s5"; }) + (fetchNuGet { pname = "System.IdentityModel.Tokens.Jwt"; version = "7.0.3"; sha256 = "1fls88ffq34j1gr6zay1crm27v3sjs5fa4mvj9akqjq05bxanlhk"; }) (fetchNuGet { pname = "System.Linq.Async"; version = "6.0.1"; sha256 = "10ira8hmv0i54yp9ggrrdm1c06j538sijfjpn1kmnh9j2xk5yzmq"; }) (fetchNuGet { pname = "System.Reflection.Metadata"; version = "1.6.0"; sha256 = "1wdbavrrkajy7qbdblpbpbalbdl48q3h34cchz24gvdgyrlf15r4"; }) (fetchNuGet { pname = "System.Runtime.CompilerServices.Unsafe"; version = "6.0.0"; sha256 = "0qm741kh4rh57wky16sq4m0v05fxmkjjr87krycf5vp9f0zbahbc"; }) diff --git a/pkgs/applications/misc/ArchiSteamFarm/update.sh b/pkgs/applications/misc/ArchiSteamFarm/update.sh index 9af9acb69835b..53d3ee6641912 100755 --- a/pkgs/applications/misc/ArchiSteamFarm/update.sh +++ b/pkgs/applications/misc/ArchiSteamFarm/update.sh @@ -1,5 +1,5 @@ #!/usr/bin/env nix-shell -#!nix-shell -I nixpkgs=./. -i bash -p curl gnused jq common-updater-scripts nix-prefetch prefetch-npm-deps +#!nix-shell -I nixpkgs=./. -i bash -p curl gnused jq common-updater-scripts set -euo pipefail cd "$(dirname "${BASH_SOURCE[0]}")" @@ -14,7 +14,7 @@ if [[ "$new_version" == "$old_version" ]]; then fi asf_path=$PWD -pushd ../../../.. +cd ../../../.. if [[ "${1:-}" != "--deps-only" ]]; then update-source-version ArchiSteamFarm "$new_version" @@ -22,5 +22,5 @@ fi $(nix-build -A ArchiSteamFarm.fetch-deps --no-out-link) -popd -"$asf_path/web-ui/update.sh" +cd "$asf_path/web-ui" +./update.sh diff --git a/pkgs/applications/misc/ArchiSteamFarm/web-ui/.gitignore b/pkgs/applications/misc/ArchiSteamFarm/web-ui/.gitignore new file mode 100644 index 0000000000000..d8b83df9cdb66 --- /dev/null +++ b/pkgs/applications/misc/ArchiSteamFarm/web-ui/.gitignore @@ -0,0 +1 @@ +package-lock.json diff --git a/pkgs/applications/misc/ArchiSteamFarm/web-ui/default.nix b/pkgs/applications/misc/ArchiSteamFarm/web-ui/default.nix index 77f4e9c6e299b..4dad0b1f5b6b5 100644 --- a/pkgs/applications/misc/ArchiSteamFarm/web-ui/default.nix +++ b/pkgs/applications/misc/ArchiSteamFarm/web-ui/default.nix @@ -1,19 +1,19 @@ -{ lib, fetchFromGitHub, buildNpmPackage, nodePackages, ArchiSteamFarm }: +{ lib, fetchFromGitHub, buildNpmPackage, ArchiSteamFarm }: -buildNpmPackage { +buildNpmPackage rec { pname = "asf-ui"; - inherit (ArchiSteamFarm) version; + version = "fceb2fb828cfa420c77dc5cde433fd519a6717d4"; src = fetchFromGitHub { owner = "JustArchiNET"; repo = "ASF-ui"; # updated by the update script # this is always the commit that should be used with asf-ui from the latest asf version - rev = "0b812a7ab0d2f01a675d27f80008ad7b6972b4aa"; - hash = "sha256-ut0x/qT3DyDASW4QbNT+BF6eXHCIbTol5E+3+tirFDA="; + rev = version; + hash = "sha256-gMQWly7HN5rIV9r72Qa+gHuBuQMs9sh09od4ja4sRGU="; }; - npmDepsHash = "sha256-HpBEoAIGejpHJnUciz4iWILcXdgpw7X1xFuXmx9Z9dw="; + npmDepsHash = "sha256-UDCQTRpcPDcuvPzlqTu315EkGr5G0+z7qMSsPgYQacA="; installPhase = '' runHook preInstall diff --git a/pkgs/applications/misc/ArchiSteamFarm/web-ui/update.sh b/pkgs/applications/misc/ArchiSteamFarm/web-ui/update.sh index 7f026383383df..6fa8e67a1217a 100755 --- a/pkgs/applications/misc/ArchiSteamFarm/web-ui/update.sh +++ b/pkgs/applications/misc/ArchiSteamFarm/web-ui/update.sh @@ -1,23 +1,19 @@ #!/usr/bin/env nix-shell -#! nix-shell -I nixpkgs=../../../.. -i bash -p nodePackages.node2nix gnused jq curl +#! nix-shell -I nixpkgs=../../../../.. -i bash -p curl gnused jq common-updater-scripts prefetch-npm-deps set -eou pipefail -cd "$(dirname "$0")" -pushd ../../../../.. +cd "$(dirname "$0")"/../../../../.. version=$(nix-instantiate --strict --eval -A ArchiSteamFarm.version | jq -r) -popd -pushd "$(dirname "$0")" +cd - ui=$(curl ${GITHUB_TOKEN:+" -u \":$GITHUB_TOKEN\""} "https://api.github.com/repos/JustArchiNET/ArchiSteamFarm/contents/ASF-ui?ref=$version" | jq -r .sha) curl "https://raw.githubusercontent.com/JustArchiNET/ASF-ui/$ui/package-lock.json" -o package-lock.json -# update-source-version doesn't work for some reason -sed -i "s/rev\\s*=\\s*.*/rev = \"$ui\";/" default.nix -sed -i "s/hash\\s*=\\s*.*/hash = \"$(nix-prefetch fetchurl --url "https://github.com/JustArchiNET/ASF-ui/archive/$ui.tar.gz")\";/" default.nix +cd - +update-source-version ArchiSteamFarm.ui "$ui" +cd - npmDepsHash=$(prefetch-npm-deps ./package-lock.json) sed -E 's#\bnpmDepsHash = ".*?"#npmDepsHash = "'"$npmDepsHash"'"#' -i default.nix rm package-lock.json - -popd diff --git a/pkgs/applications/misc/blender/default.nix b/pkgs/applications/misc/blender/default.nix index 00bbcdafff13f..8e7fde6d9c299 100644 --- a/pkgs/applications/misc/blender/default.nix +++ b/pkgs/applications/misc/blender/default.nix @@ -31,11 +31,11 @@ let in stdenv.mkDerivation (finalAttrs: rec { pname = "blender"; - version = "3.6.4"; + version = "3.6.5"; src = fetchurl { url = "https://download.blender.org/source/${pname}-${version}.tar.xz"; - hash = "sha256-zFL0GRWAtNC3C+SAspWZmGa8US92EiYQgVfiOsCJRx4="; + hash = "sha256-QAHA/pn22HLsfH6VX4Sp7r25raFxAPS1Gergjez38kM="; }; patches = [ diff --git a/pkgs/applications/misc/fluxboxlauncher/default.nix b/pkgs/applications/misc/fluxboxlauncher/default.nix index 4794e14b4698e..4794e14b4698e 100755..100644 --- a/pkgs/applications/misc/fluxboxlauncher/default.nix +++ b/pkgs/applications/misc/fluxboxlauncher/default.nix diff --git a/pkgs/applications/misc/get_iplayer/default.nix b/pkgs/applications/misc/get_iplayer/default.nix index 2483cc000f01d..fe33a7df75690 100644 --- a/pkgs/applications/misc/get_iplayer/default.nix +++ b/pkgs/applications/misc/get_iplayer/default.nix @@ -11,13 +11,13 @@ perlPackages.buildPerlPackage rec { pname = "get_iplayer"; - version = "3.31"; + version = "3.33"; src = fetchFromGitHub { owner = "get-iplayer"; repo = "get_iplayer"; rev = "v${version}"; - sha256 = "+ChCF27nmPKbqaZVxsZ6TlbzSdEz6RfMs87NE8xaSRw="; + hash = "sha256-cX+ydMvpQNFfQICRVKyhnB5gZkVnOMLPbGgdFymzmeA="; }; nativeBuildInputs = [ makeWrapper ] ++ lib.optional stdenv.isDarwin shortenPerlShebang; @@ -32,10 +32,12 @@ perlPackages.buildPerlPackage rec { installPhase = '' runHook preInstall + mkdir -p $out/bin $out/share/man/man1 cp get_iplayer $out/bin wrapProgram $out/bin/get_iplayer --suffix PATH : ${lib.makeBinPath [ atomicparsley ffmpeg ]} --prefix PERL5LIB : $PERL5LIB cp get_iplayer.1 $out/share/man/man1 + runHook postInstall ''; diff --git a/pkgs/applications/networking/browsers/brave/default.nix b/pkgs/applications/networking/browsers/brave/default.nix index 8466850808cb3..c3495160029f2 100644 --- a/pkgs/applications/networking/browsers/brave/default.nix +++ b/pkgs/applications/networking/browsers/brave/default.nix @@ -92,11 +92,11 @@ in stdenv.mkDerivation rec { pname = "brave"; - version = "1.59.117"; + version = "1.59.120"; src = fetchurl { url = "https://github.com/brave/brave-browser/releases/download/v${version}/brave-browser_${version}_amd64.deb"; - sha256 = "sha256-yckxTKAgglk6YRXist9RZufZdI22iitecmb01NmYPGQ="; + sha256 = "sha256-fkIU6XuydF6Bo8V0uS4NObh2fRuKxOWMqVft81uUs9Q="; }; dontConfigure = true; diff --git a/pkgs/applications/networking/browsers/chromium/common.nix b/pkgs/applications/networking/browsers/chromium/common.nix index 22d71e8975f80..72ae7ae6aa413 100644 --- a/pkgs/applications/networking/browsers/chromium/common.nix +++ b/pkgs/applications/networking/browsers/chromium/common.nix @@ -315,9 +315,6 @@ let sed -i -e '/lib_loader.*Load/s!"\(libudev\.so\)!"${lib.getLib systemd}/lib/\1!' \ device/udev_linux/udev?_loader.cc '' + '' - sed -i -e '/libpci_loader.*Load/s!"\(libpci\.so\)!"${pciutils}/lib/\1!' \ - gpu/config/gpu_info_collector_linux.cc - # Allow to put extensions into the system-path. sed -i -e 's,/usr,/run/current-system/sw,' chrome/common/chrome_paths.cc @@ -479,9 +476,10 @@ let postFixup = '' # Make sure that libGLESv2 and libvulkan are found by dlopen. + # libpci (from pciutils) is needed by dlopen in angle/src/gpu_info_util/SystemInfo_libpci.cpp chromiumBinary="$libExecPath/$packageName" origRpath="$(patchelf --print-rpath "$chromiumBinary")" - patchelf --set-rpath "${lib.makeLibraryPath [ libGL vulkan-loader ]}:$origRpath" "$chromiumBinary" + patchelf --set-rpath "${lib.makeLibraryPath [ libGL vulkan-loader pciutils ]}:$origRpath" "$chromiumBinary" ''; passthru = { diff --git a/pkgs/applications/networking/instant-messengers/discord/default.nix b/pkgs/applications/networking/instant-messengers/discord/default.nix index 2cd7ee2d2c5bf..0420ae8ca946b 100644 --- a/pkgs/applications/networking/instant-messengers/discord/default.nix +++ b/pkgs/applications/networking/instant-messengers/discord/default.nix @@ -1,52 +1,52 @@ { branch ? "stable", callPackage, fetchurl, lib, stdenv }: let versions = if stdenv.isLinux then { - stable = "0.0.31"; - ptb = "0.0.49"; - canary = "0.0.170"; - development = "0.0.234"; + stable = "0.0.32"; + ptb = "0.0.51"; + canary = "0.0.171"; + development = "0.0.1"; } else { - stable = "0.0.280"; - ptb = "0.0.80"; - canary = "0.0.315"; - development = "0.0.8797"; + stable = "0.0.281"; + ptb = "0.0.82"; + canary = "0.0.320"; + development = "0.0.2"; }; version = versions.${branch}; srcs = rec { x86_64-linux = { stable = fetchurl { url = "https://dl.discordapp.net/apps/linux/${version}/discord-${version}.tar.gz"; - hash = "sha256-toWwiMsEFsGaOYaPZziSmZtpzxGd9m+2MtxTrJwqFbw="; + hash = "sha256-XeGDKRKnvDyl0AWm9Vs/PDeIfAq/FL9AsjLt+dNg1HQ="; }; ptb = fetchurl { url = "https://dl-ptb.discordapp.net/apps/linux/${version}/discord-ptb-${version}.tar.gz"; - hash = "sha256-o8cDoBe6A0wBjVLjp4JXrv3QsG7TZ/Kj4+T5lj6WHdY="; + hash = "sha256-VlvGZ5qy61zse0mhvrROYwr0C94Zy1Kh4D4dp+sJTN0="; }; canary = fetchurl { url = "https://dl-canary.discordapp.net/apps/linux/${version}/discord-canary-${version}.tar.gz"; - hash = "sha256-Lw+qLAAwyoDBKDPOBA9HR79gcnqwTshFq6GMpFS0tXA="; + hash = "sha256-NcmV+DPI5hfNdBUgoaOLsjG32QfjF+x7f01B6PR10Vc="; }; development = fetchurl { url = "https://dl-development.discordapp.net/apps/linux/${version}/discord-development-${version}.tar.gz"; - hash = "sha256-R5UwgpXgb32mEohTzyRVXmumcgPl8UPan3UjmLFLxLo="; + hash = "sha256-ogLOZZ9pTXB01TqdnmdORIzZ8GbGzskUzbG4E68gZwY="; }; }; x86_64-darwin = { stable = fetchurl { url = "https://dl.discordapp.net/apps/osx/${version}/Discord.dmg"; - hash = "sha256-SUbpzd8RIf+e+so/dXZh5OkjCvWRC+EyqgeIg4u32Hg="; + hash = "sha256-Qxh9K0u99xfsVPJyAD3bFeZPxBXg2EeDyM+rbF80EC8="; }; ptb = fetchurl { url = "https://dl-ptb.discordapp.net/apps/osx/${version}/DiscordPTB.dmg"; - hash = "sha256-IvrCjiZ5Oa616+U8C2ihg8THj7ePV2A8+82wUWqWoPY="; + hash = "sha256-U99FiR3IUL8saGtVrWblWqsCIJc0rK5ZMII9/BL5H7w="; }; canary = fetchurl { url = "https://dl-canary.discordapp.net/apps/osx/${version}/DiscordCanary.dmg"; - hash = "sha256-m43SijSBxcAvYAlSFpQKIFILUm4AgSQ5F4XyQJyftts="; + hash = "sha256-7fPlb4x116HIXEJr1G7wVHriOQu6/2u69SpbU9qxHNw="; }; development = fetchurl { url = "https://dl-development.discordapp.net/apps/osx/${version}/DiscordDevelopment.dmg"; - hash = "sha256-ra0El4Y7SqanY6ZBbHE1Y+pqel4OD7nXKKfg/vndULo="; + hash = "sha256-iMw61dXtThXvz2GnZiM4+tURMRfXhrN/ze1RTBL6zy8="; }; }; aarch64-darwin = x86_64-darwin; diff --git a/pkgs/applications/networking/instant-messengers/signal-desktop/default.nix b/pkgs/applications/networking/instant-messengers/signal-desktop/default.nix index 7ae6a8a11abe0..d6118db16f3c5 100644 --- a/pkgs/applications/networking/instant-messengers/signal-desktop/default.nix +++ b/pkgs/applications/networking/instant-messengers/signal-desktop/default.nix @@ -1,12 +1,12 @@ { callPackage }: builtins.mapAttrs (pname: attrs: callPackage ./generic.nix (attrs // { inherit pname; })) { signal-desktop = { dir = "Signal"; - version = "6.32.0"; - hash = "sha256-FZ2wG3nkgIndeoUfXag/9jftXGDSY/MNpT8mqSZpJzA="; + version = "6.34.1"; + hash = "sha256-1kffRXPQmtxIsLZVOgPXDnxUmY59q+1umy25cditRhw="; }; signal-desktop-beta = { dir = "Signal Beta"; - version = "6.33.0-beta.1"; - hash = "sha256-FLCZvRYUysiE8BLMJVnn0hOkA3km0z383AjN6JvOyWI="; + version = "6.35.0-beta.2"; + hash = "sha256-TgzqKGt3ojkjq+mIu0EtqXfnnZ/xulWjiuS5/0dlwIM="; }; } diff --git a/pkgs/applications/networking/instant-messengers/teams-for-linux/default.nix b/pkgs/applications/networking/instant-messengers/teams-for-linux/default.nix index 157df8ca9a651..2307c4db01e30 100644 --- a/pkgs/applications/networking/instant-messengers/teams-for-linux/default.nix +++ b/pkgs/applications/networking/instant-messengers/teams-for-linux/default.nix @@ -19,18 +19,18 @@ stdenv.mkDerivation (finalAttrs: { pname = "teams-for-linux"; - version = "1.3.13"; + version = "1.3.14"; src = fetchFromGitHub { owner = "IsmaelMartinez"; repo = "teams-for-linux"; rev = "v${finalAttrs.version}"; - hash = "sha256-WF2jWP6utopAMZPP/ZWOhqVGZJmACwHyLLE+HQaHJjg="; + hash = "sha256-2H7j8e2wPMd4cHXDKxSmyC2Ng/B3jb3/tGVTpUOU3XM="; }; offlineCache = fetchYarnDeps { yarnLock = "${finalAttrs.src}/yarn.lock"; - hash = "sha256-vgjPGO5qa4IYfW1svClJ+wP/KtIFFd3P02T2sht69C8="; + hash = "sha256-zB6H14VAf13pAHQmsWC51d/qqyfRmAEbltyLD5ucG4Y="; }; nativeBuildInputs = [ yarn fixup_yarn_lock nodejs copyDesktopItems makeWrapper ]; diff --git a/pkgs/applications/science/biology/bowtie2/default.nix b/pkgs/applications/science/biology/bowtie2/default.nix index e5c9c28642251..356e90555f8d8 100644 --- a/pkgs/applications/science/biology/bowtie2/default.nix +++ b/pkgs/applications/science/biology/bowtie2/default.nix @@ -1,26 +1,62 @@ -{ lib, stdenv, fetchFromGitHub, cmake, tbb, zlib, python3, perl }: +{ lib +, stdenv +, fetchFromGitHub +, cmake +, perl +, python3 +, tbb +, zlib +, runCommand +, bowtie2 +}: -stdenv.mkDerivation rec { +stdenv.mkDerivation (finalAttrs: { pname = "bowtie2"; version = "2.5.2"; src = fetchFromGitHub { owner = "BenLangmead"; - repo = pname; - rev = "v${version}"; - sha256 = "sha256-Bem4SHY/74suZPDbw/rwKMLBn3bRq5ooHbBoVnKuYk0="; + repo = "bowtie2"; + rev = "refs/tags/v${finalAttrs.version}"; + fetchSubmodules = true; + hash = "sha256-rWeopeYuCk9ZhJX2SFCcxZWcjXjjTiVRiwkzLQcIgd0="; }; + # because of this flag, gcc on aarch64 cannot find the Threads + # Could NOT find Threads (missing: Threads_FOUND) + # TODO: check with other distros and report upstream + postPatch = '' + substituteInPlace CMakeLists.txt \ + --replace "-m64" "" + ''; + nativeBuildInputs = [ cmake ]; buildInputs = [ tbb zlib python3 perl ]; + cmakeFlags = lib.optional (!stdenv.hostPlatform.isx86) ["-DCMAKE_CXX_FLAGS=-I${finalAttrs.src}/third_party"]; + + # ctest fails because of missing dependencies between tests + doCheck = false; + + passthru.tests = { + ctest = runCommand "${finalAttrs.pname}-test" { } '' + mkdir $out + ${lib.getExe bowtie2} -x ${finalAttrs.src}/example/index/lambda_virus ${finalAttrs.src}/example/reads/longreads.fq -u 10 + ${bowtie2}/bin/bowtie2-build-s -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/small + ${bowtie2}/bin/bowtie2-inspect-s $out/small + ${bowtie2}/bin/bowtie2-build-l -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/large + ${bowtie2}/bin/bowtie2-inspect-l $out/large + ''; + }; + meta = with lib; { description = "An ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences"; - license = licenses.gpl3; + license = licenses.gpl3Plus; homepage = "http://bowtie-bio.sf.net/bowtie2"; + changelog = "https://github.com/BenLangmead/bowtie2/releases/tag/${finalAttrs.src.rev}"; maintainers = with maintainers; [ rybern ]; platforms = platforms.all; - broken = stdenv.isAarch64; # only x86 is supported + mainProgram = "bowtie2"; }; -} +}) diff --git a/pkgs/applications/science/biology/poretools/default.nix b/pkgs/applications/science/biology/poretools/default.nix index efbedf9a121a0..efbedf9a121a0 100755..100644 --- a/pkgs/applications/science/biology/poretools/default.nix +++ b/pkgs/applications/science/biology/poretools/default.nix diff --git a/pkgs/applications/science/biology/trimal/default.nix b/pkgs/applications/science/biology/trimal/default.nix index b27a63a2135ae..b27a63a2135ae 100755..100644 --- a/pkgs/applications/science/biology/trimal/default.nix +++ b/pkgs/applications/science/biology/trimal/default.nix diff --git a/pkgs/applications/science/biology/vcftools/default.nix b/pkgs/applications/science/biology/vcftools/default.nix index a4ec84d4d5060..a4ec84d4d5060 100755..100644 --- a/pkgs/applications/science/biology/vcftools/default.nix +++ b/pkgs/applications/science/biology/vcftools/default.nix diff --git a/pkgs/applications/science/misc/root/default.nix b/pkgs/applications/science/misc/root/default.nix index 6dc630181be2b..6b2598efc3dc8 100644 --- a/pkgs/applications/science/misc/root/default.nix +++ b/pkgs/applications/science/misc/root/default.nix @@ -57,7 +57,7 @@ stdenv.mkDerivation rec { pname = "root"; - version = "6.28.06"; + version = "6.28.08"; passthru = { tests = import ./tests { inherit callPackage; }; @@ -65,7 +65,7 @@ stdenv.mkDerivation rec { src = fetchurl { url = "https://root.cern.ch/download/root_v${version}.source.tar.gz"; - hash = "sha256-rztnO5rKOTpcmuG/huqyZyqvGEG2WMXG56MKuTxYZTM="; + hash = "sha256-o+ZLTAH4fNm75X5h75a0FibkmwRGCVBw1B2b+6NSaGI="; }; nativeBuildInputs = [ makeWrapper cmake pkg-config git ]; diff --git a/pkgs/applications/video/kodi/addons/inputstream-adaptive/default.nix b/pkgs/applications/video/kodi/addons/inputstream-adaptive/default.nix index 1e8e2ae2f4d46..61e5147be3601 100644 --- a/pkgs/applications/video/kodi/addons/inputstream-adaptive/default.nix +++ b/pkgs/applications/video/kodi/addons/inputstream-adaptive/default.nix @@ -10,13 +10,13 @@ in buildKodiBinaryAddon rec { pname = "inputstream-adaptive"; namespace = "inputstream.adaptive"; - version = "20.3.9"; + version = "20.3.13"; src = fetchFromGitHub { owner = "xbmc"; repo = "inputstream.adaptive"; rev = "${version}-${rel}"; - sha256 = "sha256-Z5p/lw7qg6aacJ0eSqswaiwTOsUmuDbNlRRs51LdjRw="; + sha256 = "sha256-xvU+DcVEaQ/1sm6o21/6N1znCtzrct0qDhMxXGFZjL4="; }; extraCMakeFlags = [ diff --git a/pkgs/applications/video/kodi/addons/netflix/default.nix b/pkgs/applications/video/kodi/addons/netflix/default.nix index ab034c13755e0..5a3089d1936d4 100644 --- a/pkgs/applications/video/kodi/addons/netflix/default.nix +++ b/pkgs/applications/video/kodi/addons/netflix/default.nix @@ -3,13 +3,13 @@ buildKodiAddon rec { pname = "netflix"; namespace = "plugin.video.netflix"; - version = "1.20.2"; + version = "1.22.3"; src = fetchFromGitHub { owner = "CastagnaIT"; repo = namespace; rev = "v${version}"; - sha256 = "sha256-k2O8a0P+TzQVoFQJkzmdqmkKh3Aj7OlsnuhJfUwxOmI="; + sha256 = "sha256-8NGj8n1p8euqYYdPDSeFh2ZE9lly5ThSmg69yXY3Te8="; }; propagatedBuildInputs = [ diff --git a/pkgs/applications/virtualization/vmware-workstation/default.nix b/pkgs/applications/virtualization/vmware-workstation/default.nix index 8fe79b6e237cb..8fe79b6e237cb 100755..100644 --- a/pkgs/applications/virtualization/vmware-workstation/default.nix +++ b/pkgs/applications/virtualization/vmware-workstation/default.nix diff --git a/pkgs/build-support/fetchdocker/credentials.nix b/pkgs/build-support/fetchdocker/credentials.nix index da19848326840..f8a229ccb6bb1 100644 --- a/pkgs/build-support/fetchdocker/credentials.nix +++ b/pkgs/build-support/fetchdocker/credentials.nix @@ -1,3 +1,4 @@ +{ lib }: # We provide three paths to get the credentials into the builder's # environment: # diff --git a/pkgs/build-support/fetchdocker/generic-fetcher.nix b/pkgs/build-support/fetchdocker/generic-fetcher.nix index 6a7b977db29f8..95b193490a82d 100644 --- a/pkgs/build-support/fetchdocker/generic-fetcher.nix +++ b/pkgs/build-support/fetchdocker/generic-fetcher.nix @@ -1,7 +1,7 @@ { stdenv, lib, haskellPackages, writeText, gawk }: let awk = "${gawk}/bin/awk"; - dockerCredentialsFile = import ./credentials.nix; + dockerCredentialsFile = import ./credentials.nix { inherit lib; }; in { fetcher , name diff --git a/pkgs/build-support/kernel/make-initrd-ng/src/main.rs b/pkgs/build-support/kernel/make-initrd-ng/src/main.rs index 53096a842329c..daa688976c6c8 100644 --- a/pkgs/build-support/kernel/make-initrd-ng/src/main.rs +++ b/pkgs/build-support/kernel/make-initrd-ng/src/main.rs @@ -195,7 +195,7 @@ fn handle_path( .wrap_err_with(|| format!("failed to resolve symlink of {:?}", source))?; // Create the link, then push its target to the queue - if !target.exists() { + if !target.exists() && !target.is_symlink() { unix::fs::symlink(&link_target, &target).wrap_err_with(|| { format!("failed to symlink {:?} to {:?}", link_target, target) })?; diff --git a/pkgs/by-name/hi/hifile/package.nix b/pkgs/by-name/hi/hifile/package.nix new file mode 100644 index 0000000000000..bf2bda5100dcd --- /dev/null +++ b/pkgs/by-name/hi/hifile/package.nix @@ -0,0 +1,41 @@ +{ lib, appimageTools, fetchurl }: + +let + version = "0.9.9.5"; + pname = "hifile"; + + src = fetchurl { + url = "https://www.hifile.app/files/HiFile-${version}.AppImage"; + hash = "sha256-Ks/NLPm5loo9q8pT0LdtfcrC38203beNE74sbEpyuJM="; + }; + + appimageContents = appimageTools.extractType2 { + inherit pname version src; + }; + +in +appimageTools.wrapType2 rec { + inherit pname version src; + + extraInstallCommands = '' + mv $out/bin/${pname}-${version} $out/bin/${pname} + + install -m 444 -D ${appimageContents}/HiFile.desktop $out/share/applications/HiFile.desktop + install -m 444 -D ${appimageContents}/HiFile.png $out/share/icons/hicolor/512x512/apps/HiFile.png + substituteInPlace $out/share/applications/HiFile.desktop \ + --replace 'Exec=HiFile' 'Exec=${pname}' + ''; + + meta = with lib; { + description = "Dual-pane graphical file manager for Windows, macOS and Linux"; + longDescription = '' + HiFile is the next evolution of file managers. Its mission is to increase your productivity whenever you work with files or folders. It aims to be better in every way - more convenient, more versatile, more efficient, more elegant, more customizable, and more fun. + ''; + homepage = "https://www.hifile.app/"; + downloadPage = "https://www.hifile.app/download"; + license = licenses.unfree; + sourceProvenance = with sourceTypes; [ binaryNativeCode ]; + maintainers = with maintainers; [ ymstnt ]; + platforms = [ "x86_64-linux" ]; + }; +} diff --git a/pkgs/by-name/tr/trealla/package.nix b/pkgs/by-name/tr/trealla/package.nix index 1a9d5569f2351..6aee9c1598b9e 100644 --- a/pkgs/by-name/tr/trealla/package.nix +++ b/pkgs/by-name/tr/trealla/package.nix @@ -17,13 +17,13 @@ assert lib.elem lineEditingLibrary [ "isocline" "readline" ]; stdenv.mkDerivation (finalAttrs: { pname = "trealla"; - version = "2.28.12"; + version = "2.29.36"; src = fetchFromGitHub { owner = "trealla-prolog"; repo = "trealla"; rev = "v${finalAttrs.version}"; - hash = "sha256-uWCpCjYFtK2pNeHHZWhWI6YZ+cllQpkKz//nHracl5s="; + hash = "sha256-tQp2DOBW71Wm1aQqspW9tuH8aM8ir+ilZiENdElB/+0="; }; postPatch = '' diff --git a/pkgs/data/fonts/vazir-fonts/default.nix b/pkgs/data/fonts/vazir-fonts/default.nix index d65b270c881f0..d65b270c881f0 100755..100644 --- a/pkgs/data/fonts/vazir-fonts/default.nix +++ b/pkgs/data/fonts/vazir-fonts/default.nix diff --git a/pkgs/development/compilers/flix/default.nix b/pkgs/development/compilers/flix/default.nix index 47a84a6e5f2d2..9ce582623fe1b 100644 --- a/pkgs/development/compilers/flix/default.nix +++ b/pkgs/development/compilers/flix/default.nix @@ -2,11 +2,11 @@ stdenvNoCC.mkDerivation rec { pname = "flix"; - version = "0.40.0"; + version = "0.41.0"; src = fetchurl { url = "https://github.com/flix/flix/releases/download/v${version}/flix.jar"; - sha256 = "sha256-NVQY2TgIR9ROy4x8PWxCjuaOkNx0bcUA4oZHjpQbHc4="; + sha256 = "sha256-bDeqwk+grkCxmGE9H8Ks7Q8KvLxNCzaLe44DlR6E7YE="; }; dontUnpack = true; diff --git a/pkgs/development/libraries/duckdb/default.nix b/pkgs/development/libraries/duckdb/default.nix index ea152c0cc099d..c9f6711780b0b 100644 --- a/pkgs/development/libraries/duckdb/default.nix +++ b/pkgs/development/libraries/duckdb/default.nix @@ -15,13 +15,13 @@ let in stdenv.mkDerivation rec { pname = "duckdb"; - version = "0.9.0"; + version = "0.9.1"; src = fetchFromGitHub { owner = pname; repo = pname; rev = "v${version}"; - hash = "sha256-EKvDH7RwOC4Gu/lturrfnGpzXnJ9azIwAFeuVoa6L/Y="; + hash = "sha256-UG/vV/6WxVLq9mdze8pSDFJIekOgGsg93dzMq6eP6Dg="; }; patches = [ ./version.patch ]; @@ -106,10 +106,12 @@ stdenv.mkDerivation rec { ''; meta = with lib; { - homepage = "https://github.com/duckdb/duckdb"; + changelog = "https://github.com/duckdb/duckdb/releases/tag/v${version}"; description = "Embeddable SQL OLAP Database Management System"; + homepage = "https://duckdb.org/"; license = licenses.mit; - platforms = platforms.all; + mainProgram = "duckdb"; maintainers = with maintainers; [ costrouc cpcloud ]; + platforms = platforms.all; }; } diff --git a/pkgs/development/libraries/duckdb/version.patch b/pkgs/development/libraries/duckdb/version.patch index 9b368eac5dbc6..f40785b430797 100644 --- a/pkgs/development/libraries/duckdb/version.patch +++ b/pkgs/development/libraries/duckdb/version.patch @@ -56,25 +56,3 @@ index 2b49e11288..0a4a69b9a0 100644 message(STATUS "git hash ${GIT_COMMIT_HASH}, version ${DUCKDB_VERSION}") -diff --git a/tools/pythonpkg/setup.py b/tools/pythonpkg/setup.py -index fdf2911019..c363cc518a 100644 ---- a/tools/pythonpkg/setup.py -+++ b/tools/pythonpkg/setup.py -@@ -163,8 +163,6 @@ if 'BUILD_HTTPFS' in os.environ: - for ext in extensions: - toolchain_args.extend(['-DDUCKDB_EXTENSION_{}_LINKED'.format(ext.upper())]) - --toolchain_args.extend(['-DDUCKDB_EXTENSION_AUTOLOAD_DEFAULT=1', '-DDUCKDB_EXTENSION_AUTOINSTALL_DEFAULT=1']) -- - - class get_pybind_include(object): - def __init__(self, user=False): -@@ -343,7 +341,7 @@ setup( - packages=packages, - include_package_data=True, - python_requires='>=3.7.0', -- setup_requires=setup_requires + ["setuptools_scm<7.0.0", 'pybind11>=2.6.0'], -+ setup_requires=setup_requires + ["setuptools_scm", 'pybind11>=2.6.0'], - use_scm_version=setuptools_scm_conf, - tests_require=['google-cloud-storage', 'mypy', 'pytest'], - classifiers=[ diff --git a/pkgs/development/libraries/libspf2/default.nix b/pkgs/development/libraries/libspf2/default.nix index b7bef29735232..997e89b82397c 100644 --- a/pkgs/development/libraries/libspf2/default.nix +++ b/pkgs/development/libraries/libspf2/default.nix @@ -1,23 +1,18 @@ -{ lib, stdenv, fetchFromGitHub, autoreconfHook, fetchpatch }: +{ lib, stdenv, fetchFromGitHub, autoreconfHook }: stdenv.mkDerivation rec { pname = "libspf2"; - version = "2.2.12"; + version = "2.2.13"; src = fetchFromGitHub { owner = "helsinki-systems"; repo = "libspf2"; rev = "v${version}"; - sha256 = "03iiaafdcwh220pqignk407h6klrakwz0zkb8iwk6nkwipkwvhsx"; + hash = "sha256-tkCHP3B1sBb0+scHBjX5lCvaeSrZryfaGKye02LFlYs="; }; - patches = [ - # glibc-2.34 compat - (fetchpatch { - url = "https://raw.githubusercontent.com/gentoo/gentoo/dbb8a5c9f749cc11e61cfe558f164b165cbc30cb/mail-filter/libspf2/files/libspf2-1.2.11-undefined-dn_.patch"; - sha256 = "sha256-6JVVkVGCcFJsNeBdVTPcLhW4KoHLY4ai/KXDMliXgPA="; - }) - ]; + nativeBuildInputs = [ autoreconfHook ]; + strictDeps = true; postPatch = '' # disable static bins compilation @@ -28,9 +23,6 @@ stdenv.mkDerivation rec { -e '/bin_PROGRAMS/s/spf_example_static//' src/spf_example/Makefile.am ''; - # autoreconf necessary because we modified automake files - nativeBuildInputs = [ autoreconfHook ]; - doCheck = true; meta = with lib; { diff --git a/pkgs/development/libraries/virglrenderer/default.nix b/pkgs/development/libraries/virglrenderer/default.nix index 42ce297d45638..f64de57fcb89d 100644 --- a/pkgs/development/libraries/virglrenderer/default.nix +++ b/pkgs/development/libraries/virglrenderer/default.nix @@ -1,23 +1,21 @@ -{ lib, stdenv, fetchurl, cmake, meson, ninja, pkg-config, python3 +{ lib, stdenv, fetchurl, meson, ninja, pkg-config, python3 , libGLU, libepoxy, libX11, libdrm, mesa }: stdenv.mkDerivation rec { pname = "virglrenderer"; - version = "0.10.4"; + version = "1.0.0"; src = fetchurl { - url = "https://gitlab.freedesktop.org/virgl/virglrenderer/-/archive/virglrenderer-${version}/virglrenderer-virglrenderer-${version}.tar.bz2"; - sha256 = "sha256-qqvnko2sN4bdm9+F0PVjDW5FsiL5k3UAfjPSTqG+73c="; + url = "https://gitlab.freedesktop.org/virgl/virglrenderer/-/archive/${version}/virglrenderer-${version}.tar.bz2"; + hash = "sha256-KMGPP2MeuATHFXKr5oW9HuFOMmmYpmkVLvMvQi0cEdg="; }; separateDebugInfo = true; buildInputs = [ libGLU libepoxy libX11 libdrm mesa ]; - nativeBuildInputs = [ cmake meson ninja pkg-config python3 ]; - - dontUseCmakeConfigure = true; + nativeBuildInputs = [ meson ninja pkg-config python3 ]; meta = with lib; { description = "A virtual 3D GPU library that allows a qemu guest to use the host GPU for accelerated 3D rendering"; diff --git a/pkgs/development/libraries/zlib-ng/default.nix b/pkgs/development/libraries/zlib-ng/default.nix index 3f2ba22ea430c..2d3ba583cfd5b 100644 --- a/pkgs/development/libraries/zlib-ng/default.nix +++ b/pkgs/development/libraries/zlib-ng/default.nix @@ -5,13 +5,13 @@ stdenv.mkDerivation rec { pname = "zlib-ng"; - version = "2.1.3"; + version = "2.1.4"; src = fetchFromGitHub { owner = "zlib-ng"; repo = "zlib-ng"; rev = version; - hash = "sha256-DC4KPPaMuqML0HEhWJmWjyox4WEbExPDfNnpnWzoaHc="; + hash = "sha256-okNmobCVAC9y7tjZqFd0DBhOjs3WWRPK8jvK1j9G29k="; }; outputs = [ "out" "dev" "bin" ]; diff --git a/pkgs/development/php-packages/opentelemetry/default.nix b/pkgs/development/php-packages/opentelemetry/default.nix index 2bef82d8d8e9b..346a3cb369516 100644 --- a/pkgs/development/php-packages/opentelemetry/default.nix +++ b/pkgs/development/php-packages/opentelemetry/default.nix @@ -1,7 +1,7 @@ { lib, buildPecl, fetchFromGitHub }: let - version = "1.0.0RC2"; + version = "1.0.0RC3"; in buildPecl { inherit version; pname = "opentelemetry"; @@ -10,7 +10,7 @@ in buildPecl { owner = "open-telemetry"; repo = "opentelemetry-php-instrumentation"; rev = version; - hash = "sha256-sCsJ4ZmQXTTG+ZxDzw3b6Su/8QUAVZv7vV6SuLBET+0="; + hash = "sha256-0jHXl+Amjv0vLSuSWhkGAU25pkRXbJgdx02N6o2dUyw="; }; sourceRoot = "source/ext"; diff --git a/pkgs/development/php-packages/xdebug/default.nix b/pkgs/development/php-packages/xdebug/default.nix index 61e83d9187655..3aa24ce15e43c 100644 --- a/pkgs/development/php-packages/xdebug/default.nix +++ b/pkgs/development/php-packages/xdebug/default.nix @@ -1,7 +1,7 @@ { buildPecl, lib, fetchFromGitHub }: let - version = "3.2.2"; + version = "3.3.0alpha3"; in buildPecl { inherit version; @@ -11,7 +11,7 @@ in buildPecl { owner = "xdebug"; repo = "xdebug"; rev = version; - hash = "sha256-zbgJw2oPzyUTK0UwLAqpShBi+toVsEQcjoG4tIBder0="; + hash = "sha256-LBrKQCR4qpV3yJpTknUNKX6mq+qSdBSveIoYmk5Vmoc="; }; doCheck = true; diff --git a/pkgs/development/python-modules/aioelectricitymaps/default.nix b/pkgs/development/python-modules/aioelectricitymaps/default.nix new file mode 100644 index 0000000000000..502363de13c3a --- /dev/null +++ b/pkgs/development/python-modules/aioelectricitymaps/default.nix @@ -0,0 +1,55 @@ +{ lib +, aiohttp +, aresponses +, buildPythonPackage +, dataclasses-json +, fetchFromGitHub +, poetry-core +, pytest-asyncio +, pytestCheckHook +, pythonOlder +, syrupy +}: + +buildPythonPackage rec { + pname = "aioelectricitymaps"; + version = "0.1.3"; + pyproject = true; + + disabled = pythonOlder "3.10"; + + src = fetchFromGitHub { + owner = "jpbede"; + repo = "aioelectricitymaps"; + rev = "refs/tags/v${version}"; + hash = "sha256-2Ou3obpGRJ/iUPuaoBGlmDTJLx6+S8ivK9PbrbSvYyg="; + }; + + nativeBuildInputs = [ + poetry-core + ]; + + propagatedBuildInputs = [ + aiohttp + dataclasses-json + ]; + + nativeCheckInputs = [ + aresponses + pytest-asyncio + pytestCheckHook + syrupy + ]; + + pythonImportsCheck = [ + "aioelectricitymaps" + ]; + + meta = with lib; { + description = "Module for interacting with Electricity maps"; + homepage = "https://github.com/jpbede/aioelectricitymaps"; + changelog = "https://github.com/jpbede/aioelectricitymaps/releases/tag/v${version}"; + license = licenses.mit; + maintainers = with maintainers; [ fab ]; + }; +} diff --git a/pkgs/development/python-modules/async-upnp-client/default.nix b/pkgs/development/python-modules/async-upnp-client/default.nix index 03b7e8664c467..c51c99d00f0b4 100644 --- a/pkgs/development/python-modules/async-upnp-client/default.nix +++ b/pkgs/development/python-modules/async-upnp-client/default.nix @@ -15,7 +15,7 @@ buildPythonPackage rec { pname = "async-upnp-client"; - version = "0.36.1"; + version = "0.36.2"; format = "setuptools"; disabled = pythonOlder "3.8"; @@ -24,7 +24,7 @@ buildPythonPackage rec { owner = "StevenLooman"; repo = "async_upnp_client"; rev = "refs/tags/${version}"; - hash = "sha256-NFSJlBRVgeuhK7IXjNz2g6SbSgveSjaJpSQrxSACG04="; + hash = "sha256-f3x5adxLHT/C5dXfdBH6stKv0y2nuhbpe8jkJex1DKU="; }; propagatedBuildInputs = [ diff --git a/pkgs/development/python-modules/asyncwhois/default.nix b/pkgs/development/python-modules/asyncwhois/default.nix index 25cb21e7e2464..e462a0d0b49c1 100644 --- a/pkgs/development/python-modules/asyncwhois/default.nix +++ b/pkgs/development/python-modules/asyncwhois/default.nix @@ -12,7 +12,7 @@ buildPythonPackage rec { pname = "asyncwhois"; - version = "1.0.8"; + version = "1.0.9"; format = "setuptools"; disabled = pythonOlder "3.7"; @@ -21,7 +21,7 @@ buildPythonPackage rec { owner = "pogzyb"; repo = "asyncwhois"; rev = "refs/tags/v${version}"; - hash = "sha256-fYXxoS4bGTat5QT98ETmWk/VKXJmg9mtkUu02SZT4Eo="; + hash = "sha256-5T/h4YzODH7zFyQpG8qVZetTK7V+Ii9jc+MQFgMUA8w="; }; propagatedBuildInputs = [ diff --git a/pkgs/development/python-modules/atlassian-python-api/default.nix b/pkgs/development/python-modules/atlassian-python-api/default.nix index fd389308c9315..fd389308c9315 100755..100644 --- a/pkgs/development/python-modules/atlassian-python-api/default.nix +++ b/pkgs/development/python-modules/atlassian-python-api/default.nix diff --git a/pkgs/development/python-modules/bespon/default.nix b/pkgs/development/python-modules/bespon/default.nix index da6820ef6ecc2..a942651dcb73e 100644 --- a/pkgs/development/python-modules/bespon/default.nix +++ b/pkgs/development/python-modules/bespon/default.nix @@ -1,18 +1,20 @@ { lib , buildPythonPackage , fetchPypi +, setuptools }: buildPythonPackage rec { - version = "0.6.0"; - pname = "BespON"; + version = "0.7.0"; + pname = "bespon"; + format = "pyproject"; src = fetchPypi { inherit pname version; - sha256 = "2f2bda67fea8ee95c8aa7e885835ab88bdbfa392a94077ce1c9d29017420ce7a"; + hash = "sha256-dGtXw4uq6pdyXBVfSi9s7kCFUqA1PO7qWEGY0JNAz8Q="; }; - propagatedBuildInputs = [ ]; + nativeBuildInputs = [ setuptools ]; # upstream doesn't contain tests doCheck = false; diff --git a/pkgs/development/python-modules/cantools/default.nix b/pkgs/development/python-modules/cantools/default.nix new file mode 100644 index 0000000000000..3cb260dd8d1bb --- /dev/null +++ b/pkgs/development/python-modules/cantools/default.nix @@ -0,0 +1,58 @@ +{ lib +, buildPythonPackage +, fetchPypi +, setuptools-scm +, argparse-addons +, bitstruct +, can +, crccheck +, diskcache +, matplotlib +, parameterized +, pytestCheckHook +, pythonOlder +, textparser +}: + +buildPythonPackage rec { + pname = "cantools"; + version = "38.0.2"; + format = "setuptools"; + + disabled = pythonOlder "3.7"; + + src = fetchPypi { + inherit pname version; + hash = "sha256-k7/m9L1lLzaXY+qRYrAnpi9CSoQA8kI9QRN5GM5oxo4="; + }; + + nativeBuildInputs = [ + setuptools-scm + ]; + + propagatedBuildInputs = [ + argparse-addons + bitstruct + can + crccheck + diskcache + matplotlib + textparser + ]; + + nativeCheckInputs = [ + parameterized + pytestCheckHook + ]; + + pythonImportsCheck = [ + "cantools" + ]; + + meta = with lib; { + homepage = "https://github.com/cantools/cantools"; + description = "CAN bus tools."; + license = licenses.mit; + maintainers = with maintainers; [ gray-heron ]; + }; +} diff --git a/pkgs/development/python-modules/certbot-dns-ovh/default.nix b/pkgs/development/python-modules/certbot-dns-ovh/default.nix new file mode 100644 index 0000000000000..da0dd57cff874 --- /dev/null +++ b/pkgs/development/python-modules/certbot-dns-ovh/default.nix @@ -0,0 +1,39 @@ +{ buildPythonPackage +, acme +, certbot +, dns-lexicon +, pytestCheckHook +, pythonOlder +}: + +buildPythonPackage rec { + pname = "certbot-dns-ovh"; + + inherit (certbot) src version; + disabled = pythonOlder "3.6"; + + sourceRoot = "${src.name}/certbot-dns-ovh"; + + propagatedBuildInputs = [ + acme + certbot + dns-lexicon + ]; + + nativeCheckInputs = [ + pytestCheckHook + ]; + + pytestFlagsArray = [ + "-o cache_dir=$(mktemp -d)" + + # Monitor https://github.com/certbot/certbot/issues/9606 for a solution + "-W 'ignore:pkg_resources is deprecated as an API:DeprecationWarning'" + "-W 'ignore:Package lexicon.providers is deprecated and will be removed in Lexicon 4>=.:DeprecationWarning'" + "-W 'ignore:Legacy configuration object has been used to load the ConfigResolver.:DeprecationWarning'" + ]; + + meta = certbot.meta // { + description = "OVH DNS Authenticator plugin for Certbot"; + }; +} diff --git a/pkgs/development/python-modules/chex/default.nix b/pkgs/development/python-modules/chex/default.nix index 047073587b261..6bee1641242c0 100644 --- a/pkgs/development/python-modules/chex/default.nix +++ b/pkgs/development/python-modules/chex/default.nix @@ -15,16 +15,16 @@ buildPythonPackage rec { pname = "chex"; - version = "0.1.83"; + version = "0.1.84"; format = "setuptools"; disabled = pythonOlder "3.9"; src = fetchFromGitHub { owner = "deepmind"; - repo = pname; + repo = "chex"; rev = "refs/tags/v${version}"; - hash = "sha256-iEachJf5NjOnkMWdP0aVQHWNPgUUBkMnzHKq3GP7t4w="; + hash = "sha256-LsUMvSMVGjqZuFDcb+/61RtFxweeG6bSFzmJUUMv6rA="; }; propagatedBuildInputs = [ diff --git a/pkgs/development/python-modules/duckdb/default.nix b/pkgs/development/python-modules/duckdb/default.nix index e9aac74d835e7..5ff9956849926 100644 --- a/pkgs/development/python-modules/duckdb/default.nix +++ b/pkgs/development/python-modules/duckdb/default.nix @@ -13,17 +13,19 @@ }: buildPythonPackage rec { - inherit (duckdb) pname version src patches; + inherit (duckdb) pname version src; format = "setuptools"; - postPatch = '' + # 1. let nix control build cores + # 2. default to extension autoload & autoinstall disabled + # 3. unconstrain setuptools_scm version + patches = (duckdb.patches or []) ++ [ ./setup.patch ]; + + postPatch = (duckdb.postPatch or "") + '' # we can't use sourceRoot otherwise patches don't apply, because the patches apply to the C++ library cd tools/pythonpkg - # 1. let nix control build cores - # 2. unconstrain setuptools_scm version - substituteInPlace setup.py \ - --replace "multiprocessing.cpu_count()" "$NIX_BUILD_CORES" + substituteInPlace setup.py --subst-var NIX_BUILD_CORES # avoid dependency on mypy rm tests/stubs/test_stubs.py @@ -54,6 +56,8 @@ buildPythonPackage rec { disabledTests = [ # tries to make http request "test_install_non_existent_extension" + # test is racy and interrupt can be delivered before or after target point + "test_connection_interrupt" ]; preCheck = '' diff --git a/pkgs/development/python-modules/duckdb/setup.patch b/pkgs/development/python-modules/duckdb/setup.patch new file mode 100644 index 0000000000000..8c8f790a66a1d --- /dev/null +++ b/pkgs/development/python-modules/duckdb/setup.patch @@ -0,0 +1,30 @@ +diff --git a/tools/pythonpkg/setup.py b/tools/pythonpkg/setup.py +index 30f1e1ccdd..6784169fcb 100644 +--- a/tools/pythonpkg/setup.py ++++ b/tools/pythonpkg/setup.py +@@ -96,7 +96,7 @@ def parallel_cpp_compile( + return + self._compile(obj, src, ext, cc_args, extra_postargs, pp_opts) + +- list(multiprocessing.pool.ThreadPool(multiprocessing.cpu_count()).imap(_single_compile, objects)) ++ list(multiprocessing.pool.ThreadPool(@NIX_BUILD_CORES@).imap(_single_compile, objects)) + return objects + + +@@ -163,7 +163,6 @@ if 'BUILD_HTTPFS' in os.environ: + for ext in extensions: + toolchain_args.extend(['-DDUCKDB_EXTENSION_{}_LINKED'.format(ext.upper())]) + +-toolchain_args.extend(['-DDUCKDB_EXTENSION_AUTOLOAD_DEFAULT=1', '-DDUCKDB_EXTENSION_AUTOINSTALL_DEFAULT=1']) + + + class get_pybind_include(object): +@@ -348,7 +347,7 @@ setup( + packages=packages, + include_package_data=True, + python_requires='>=3.7.0', +- setup_requires=setup_requires + ["setuptools_scm<7.0.0", 'pybind11>=2.6.0'], ++ setup_requires=setup_requires + ["setuptools_scm", 'pybind11>=2.6.0'], + use_scm_version=setuptools_scm_conf, + tests_require=['google-cloud-storage', 'mypy', 'pytest'], + classifiers=[ diff --git a/pkgs/development/python-modules/elgato/default.nix b/pkgs/development/python-modules/elgato/default.nix index 92b4cad66b5cd..3aeab819b76a5 100644 --- a/pkgs/development/python-modules/elgato/default.nix +++ b/pkgs/development/python-modules/elgato/default.nix @@ -13,18 +13,25 @@ buildPythonPackage rec { pname = "elgato"; - version = "4.0.1"; + version = "5.0.0"; format = "pyproject"; - disabled = pythonOlder "3.9"; + disabled = pythonOlder "3.11"; src = fetchFromGitHub { owner = "frenck"; repo = "python-elgato"; rev = "refs/tags/v${version}"; - hash = "sha256-kyFnc/lMxgYy8s/gAP5vpEPV8a+dphOummr6G7deGQ4="; + hash = "sha256-TI5wu2FYVUMvgDkbktcwPLnTSD8XUSy8qwOCdrsiopk="; }; + postPatch = '' + # Upstream doesn't set a version for the pyproject.toml + substituteInPlace pyproject.toml \ + --replace "0.0.0" "${version}" \ + --replace "--cov" "" + ''; + nativeBuildInputs = [ poetry-core ]; @@ -41,13 +48,6 @@ buildPythonPackage rec { pytestCheckHook ]; - postPatch = '' - # Upstream doesn't set a version for the pyproject.toml - substituteInPlace pyproject.toml \ - --replace "0.0.0" "${version}" \ - --replace "--cov" "" - ''; - pythonImportsCheck = [ "elgato" ]; @@ -55,6 +55,7 @@ buildPythonPackage rec { meta = with lib; { description = "Python client for Elgato Key Lights"; homepage = "https://github.com/frenck/python-elgato"; + changelog = "https://github.com/frenck/python-elgato/releases/tag/v${version}"; license = with licenses; [ mit ]; maintainers = with maintainers; [ fab ]; }; diff --git a/pkgs/development/python-modules/gpaw/default.nix b/pkgs/development/python-modules/gpaw/default.nix index 913f1616a07d4..e359c78c66f86 100644 --- a/pkgs/development/python-modules/gpaw/default.nix +++ b/pkgs/development/python-modules/gpaw/default.nix @@ -74,13 +74,13 @@ let in buildPythonPackage rec { pname = "gpaw"; - version = "22.8.0"; + version = "23.9.1"; src = fetchFromGitLab { owner = "gpaw"; repo = pname; rev = version; - hash = "sha256-Kgf8yuGua7mcGP+jVVmbE8JCsbrfzewRTRt3ihq9YX4="; + hash = "sha256-9nnK4ksTFATO6HexnxfMiih/yoY/noyJZXZOaDG/2kc="; }; # `inetutils` is required because importing `gpaw`, as part of diff --git a/pkgs/development/python-modules/guppy3/default.nix b/pkgs/development/python-modules/guppy3/default.nix index c47fb6a80425c..65d7c2622a8ef 100644 --- a/pkgs/development/python-modules/guppy3/default.nix +++ b/pkgs/development/python-modules/guppy3/default.nix @@ -7,14 +7,14 @@ buildPythonPackage rec { pname = "guppy3"; - version = "3.1.3"; + version = "3.1.4"; disabled = pythonOlder "3.6"; src = fetchFromGitHub { owner = "zhuyifei1999"; repo = pname; rev = "v${version}"; - hash = "sha256-i3WqXlNnNhBVw9rdnxnzQISFkZHBpc/gqG+rxOWPiyc="; + hash = "sha256-RMWIP4tVSCCEQpr0kZvsN1HwL6rBcLuubfBl175eSNg="; }; propagatedBuildInputs = [ tkinter ]; diff --git a/pkgs/development/python-modules/jax/default.nix b/pkgs/development/python-modules/jax/default.nix index 9453ba1c0c6c5..d9293e0734801 100644 --- a/pkgs/development/python-modules/jax/default.nix +++ b/pkgs/development/python-modules/jax/default.nix @@ -27,17 +27,17 @@ let in buildPythonPackage rec { pname = "jax"; - version = "0.4.18"; + version = "0.4.19"; pyproject = true; disabled = pythonOlder "3.9"; src = fetchFromGitHub { owner = "google"; - repo = pname; + repo = "jax"; # google/jax contains tags for jax and jaxlib. Only use jax tags! rev = "refs/tags/${pname}-v${version}"; - hash = "sha256-rDvWHa8jYCAA9iKbWaFUXdE/9L7AepFiNzmqOcc/090="; + hash = "sha256-l5uLPqhg/hqtO9oJSaioow5cH/0jKHDVziGezkfnVcc="; }; nativeBuildInputs = [ diff --git a/pkgs/development/python-modules/jaxlib/bin.nix b/pkgs/development/python-modules/jaxlib/bin.nix index 68a1275246aa0..8b673d6040d53 100644 --- a/pkgs/development/python-modules/jaxlib/bin.nix +++ b/pkgs/development/python-modules/jaxlib/bin.nix @@ -39,7 +39,7 @@ in assert cudaSupport -> lib.versionAtLeast cudatoolkit.version "11.1" && lib.versionAtLeast cudnn.version "8.2" && stdenv.isLinux; let - version = "0.4.18"; + version = "0.4.19"; inherit (python) pythonVersion; @@ -60,15 +60,15 @@ let { "x86_64-linux" = getSrcFromPypi { platform = "manylinux2014_x86_64"; - hash = "sha256-MpNomovvSVx4N6gsowOLksTyEgTK261vSXMGxYqlVOE="; + hash = "sha256-ksnY+CPEstact5lKjbSg+ZSPJtSt0Y0NFWEFufBCByk="; }; "aarch64-darwin" = getSrcFromPypi { platform = "macosx_11_0_arm64"; - hash = "sha256-if/5O5DQVHFdsLw9O1creZBx5j8ftE7fsWMMX1NjHP0="; + hash = "sha256-O7dHvdKLKfNELGfF4TKy7N5EX6Ca7Zu8OtLXWvFykR8="; }; "x86_64-darwin" = getSrcFromPypi { platform = "macosx_10_14_x86_64"; - hash = "sha256-4NeHA/0SGdmHXyDGxpK7oJc7dE1meR4LPjzbIwxloqU="; + hash = "sha256-gqKMUZSXrt8sQtTAoQbzAfCzO8gM9Y1/tZpuJVWyN0Y="; }; }; @@ -78,7 +78,7 @@ let # https://github.com/google/jax/issues/12879 as to why this specific URL is the correct index. gpuSrc = fetchurl { url = "https://storage.googleapis.com/jax-releases/cuda12/jaxlib-${version}+cuda12.cudnn89-cp310-cp310-manylinux2014_x86_64.whl"; - hash = "sha256-p6BNvhhRzVDQdpEoIRau5JovC+eDjlW3bXrahtsGvmI="; + hash = "sha256-zfN0n31+5GohwBkeQrqHus4qOyhM/GEdqG6KUupCZ4o="; }; in diff --git a/pkgs/development/python-modules/jaxlib/default.nix b/pkgs/development/python-modules/jaxlib/default.nix index 35d56ff1a1eb6..d02cb0aa5dee2 100644 --- a/pkgs/development/python-modules/jaxlib/default.nix +++ b/pkgs/development/python-modules/jaxlib/default.nix @@ -54,7 +54,7 @@ let inherit (cudaPackages) backendStdenv cudatoolkit cudaFlags cudnn nccl; pname = "jaxlib"; - version = "0.4.18"; + version = "0.4.19"; meta = with lib; { description = "JAX is Autograd and XLA, brought together for high-performance machine learning research."; @@ -151,7 +151,7 @@ let repo = "jax"; # google/jax contains tags for jax and jaxlib. Only use jaxlib tags! rev = "refs/tags/${pname}-v${version}"; - hash = "sha256-rDvWHa8jYCAA9iKbWaFUXdE/9L7AepFiNzmqOcc/090="; + hash = "sha256-l5uLPqhg/hqtO9oJSaioow5cH/0jKHDVziGezkfnVcc="; }; nativeBuildInputs = [ @@ -264,10 +264,10 @@ let ]; sha256 = (if cudaSupport then { - x86_64-linux = "sha256-0CfGWlwKsUFP1DHUN6+6wX3cHr5x3TE6NbqYlV5me1E="; + x86_64-linux = "sha256-Z5cSgdRxdKxidaz4b1RlUF4rVcQiUTmQ1OorlBWlpt0="; } else { - x86_64-linux = "sha256-sljmyIligXC7d9fdlpqR32xyMR0UslWs04gXJBD8FTA="; - aarch64-linux = "sha256-eJ4KIkHdcA2EVvyBoNum2cOPcHPFoBOtUTAGufO8FJA="; + x86_64-linux = "sha256-sn7p8FFHWIVdBWnsLsVj5jLiSaTlRm7s/qj2RqvQ3jU="; + aarch64-linux = "sha256-oAYF5AeuPHTlwtpDMs2+tAhRAJH0yeSVnB7Ni7wmzS8="; }).${stdenv.system} or (throw "jaxlib: unsupported system: ${stdenv.system}"); }; diff --git a/pkgs/development/python-modules/lsprotocol/default.nix b/pkgs/development/python-modules/lsprotocol/default.nix index a2e17eb400421..5ee4d3ed11260 100644 --- a/pkgs/development/python-modules/lsprotocol/default.nix +++ b/pkgs/development/python-modules/lsprotocol/default.nix @@ -4,6 +4,7 @@ , cattrs , fetchFromGitHub , flit-core +, importlib-resources , jsonschema , nox , pyhamcrest @@ -13,7 +14,7 @@ buildPythonPackage rec { pname = "lsprotocol"; - version = "2023.0.0a2"; + version = "2023.0.0b1"; format = "pyproject"; disabled = pythonOlder "3.7"; @@ -22,7 +23,7 @@ buildPythonPackage rec { owner = "microsoft"; repo = pname; rev = "refs/tags/${version}"; - hash = "sha256-AEvs2fb8nhWEFMyLvwNv9HoxxxE50/KW3TGZ5pDf4dc="; + hash = "sha256-Y/Mp/8MskRB6irNU3CBOKmo2Zt5S69h+GyMg71sQ9Uw="; }; nativeBuildInputs = [ @@ -40,6 +41,7 @@ buildPythonPackage rec { ]; checkInputs = [ + importlib-resources jsonschema pyhamcrest ]; diff --git a/pkgs/development/python-modules/num2words/default.nix b/pkgs/development/python-modules/num2words/default.nix index 82ba5a8cec109..c43cb81eb2fc7 100644 --- a/pkgs/development/python-modules/num2words/default.nix +++ b/pkgs/development/python-modules/num2words/default.nix @@ -7,12 +7,12 @@ }: buildPythonPackage rec { - version = "0.5.12"; + version = "0.5.13"; pname = "num2words"; src = fetchPypi { inherit pname version; - hash = "sha256-fnwLDwgEBao6HdnTKxypCzvwO6sXuOVNsF4beDAaCYg="; + hash = "sha256-owZHFvu/kNdcRJRQzr+8c6ahPmOyUx0JvezDqxoiCc8="; }; propagatedBuildInputs = [ docopt ]; diff --git a/pkgs/development/python-modules/osmnx/default.nix b/pkgs/development/python-modules/osmnx/default.nix index fec12037e20b5..fec12037e20b5 100755..100644 --- a/pkgs/development/python-modules/osmnx/default.nix +++ b/pkgs/development/python-modules/osmnx/default.nix diff --git a/pkgs/development/python-modules/peaqevcore/default.nix b/pkgs/development/python-modules/peaqevcore/default.nix index 38397535c01f7..33e65661f92e1 100644 --- a/pkgs/development/python-modules/peaqevcore/default.nix +++ b/pkgs/development/python-modules/peaqevcore/default.nix @@ -6,14 +6,14 @@ buildPythonPackage rec { pname = "peaqevcore"; - version = "19.5.4"; + version = "19.5.5"; format = "setuptools"; disabled = pythonOlder "3.7"; src = fetchPypi { inherit pname version; - hash = "sha256-AkVUYUZobQsnSfMfciiSbPwo0HCnlO3NLoUA1+wqBt4="; + hash = "sha256-AgJT/VfNHcSuJhypBwqJkgXuvYDBlZ7eQp4nGva4z6U="; }; postPatch = '' diff --git a/pkgs/development/python-modules/persim/default.nix b/pkgs/development/python-modules/persim/default.nix index 09feb66549a46..869fb6146f2e9 100644 --- a/pkgs/development/python-modules/persim/default.nix +++ b/pkgs/development/python-modules/persim/default.nix @@ -16,14 +16,14 @@ buildPythonPackage rec { pname = "persim"; - version = "0.3.1"; + version = "0.3.2"; format = "setuptools"; disabled = pythonOlder "3.7"; src = fetchPypi { inherit pname version; - hash = "sha256-7w8KJHrc9hBOysFBF9sLJFgXEOqKjZZIFoBTlXALSXU="; + hash = "sha256-p6Vumfr+vRDr0D9PnEZItp9vNlCLIb59HpBg1KdyHGE="; }; propagatedBuildInputs = [ diff --git a/pkgs/development/python-modules/plugwise/default.nix b/pkgs/development/python-modules/plugwise/default.nix index 8876eea828afd..22e0a62827620 100644 --- a/pkgs/development/python-modules/plugwise/default.nix +++ b/pkgs/development/python-modules/plugwise/default.nix @@ -20,7 +20,7 @@ buildPythonPackage rec { pname = "plugwise"; - version = "0.33.1"; + version = "0.33.2"; format = "setuptools"; disabled = pythonOlder "3.7"; @@ -29,7 +29,7 @@ buildPythonPackage rec { owner = pname; repo = "python-plugwise"; rev = "refs/tags/v${version}"; - hash = "sha256-uJBUim5FlS+Jw3rGEKuorksVIgI5tVRAI7tESeYnGUc="; + hash = "sha256-WTgv0bEkhLMoRCw6Xh5SlYLxnlQCv603lKTajjCETT4="; }; propagatedBuildInputs = [ diff --git a/pkgs/development/python-modules/pvo/default.nix b/pkgs/development/python-modules/pvo/default.nix index 6f3f698fe2c74..6963d37000138 100644 --- a/pkgs/development/python-modules/pvo/default.nix +++ b/pkgs/development/python-modules/pvo/default.nix @@ -13,18 +13,25 @@ buildPythonPackage rec { pname = "pvo"; - version = "1.0.0"; + version = "2.0.0"; format = "pyproject"; - disabled = pythonOlder "3.10"; + disabled = pythonOlder "3.11"; src = fetchFromGitHub { owner = "frenck"; repo = "python-pvoutput"; rev = "refs/tags/v${version}"; - hash = "sha256-6oVACUnK8WVlEx047CUXmSXQ0+M3xnSvyMHw5Wttk7M="; + hash = "sha256-SvsrvGwIAlj/8hdk90+rxigVrx6n3YInvF/4eux2H04="; }; + postPatch = '' + # Upstream doesn't set a version for the pyproject.toml + substituteInPlace pyproject.toml \ + --replace "0.0.0" "${version}" \ + --replace "--cov" "" + ''; + nativeBuildInputs = [ poetry-core ]; @@ -41,13 +48,6 @@ buildPythonPackage rec { pytestCheckHook ]; - postPatch = '' - # Upstream doesn't set a version for the pyproject.toml - substituteInPlace pyproject.toml \ - --replace "0.0.0" "${version}" \ - --replace "--cov" "" - ''; - pythonImportsCheck = [ "pvo" ]; diff --git a/pkgs/development/python-modules/pyduotecno/default.nix b/pkgs/development/python-modules/pyduotecno/default.nix index e61e725a80a1b..17fd2d78885c4 100644 --- a/pkgs/development/python-modules/pyduotecno/default.nix +++ b/pkgs/development/python-modules/pyduotecno/default.nix @@ -8,7 +8,7 @@ buildPythonPackage rec { pname = "pyduotecno"; - version = "2023.10.0"; + version = "2023.10.1"; format = "pyproject"; disabled = pythonOlder "3.9"; @@ -17,7 +17,7 @@ buildPythonPackage rec { owner = "Cereal2nd"; repo = "pyDuotecno"; rev = "refs/tags/${version}"; - hash = "sha256-GxCqWgw4OdhJUMsGzCZnl6KYH7HQpGyV7zXMxbShHlg="; + hash = "sha256-fDooQb1i9rgzDZBzZ+lYb0WUYC8JNPEYk5DJ9wtS2Dg="; }; nativeBuildInputs = [ diff --git a/pkgs/development/python-modules/pyenphase/default.nix b/pkgs/development/python-modules/pyenphase/default.nix index 360db91241756..d18160d897d38 100644 --- a/pkgs/development/python-modules/pyenphase/default.nix +++ b/pkgs/development/python-modules/pyenphase/default.nix @@ -18,7 +18,7 @@ buildPythonPackage rec { pname = "pyenphase"; - version = "1.12.0"; + version = "1.13.1"; format = "pyproject"; disabled = pythonOlder "3.11"; @@ -27,7 +27,7 @@ buildPythonPackage rec { owner = "pyenphase"; repo = "pyenphase"; rev = "refs/tags/v${version}"; - hash = "sha256-gqbRz0JAp8hjZpFUzlFzqq86UKgD0TLWSp1Z9rdrk3s="; + hash = "sha256-8wGGx7ERYm+lKvLW/NUcJeBTqEXPM0jJNOOlkj/UzYk="; }; postPatch = '' diff --git a/pkgs/development/python-modules/pytensor/default.nix b/pkgs/development/python-modules/pytensor/default.nix index dcb41604102f3..06d0dffb24689 100644 --- a/pkgs/development/python-modules/pytensor/default.nix +++ b/pkgs/development/python-modules/pytensor/default.nix @@ -26,7 +26,7 @@ buildPythonPackage rec { pname = "pytensor"; - version = "2.17.2"; + version = "2.17.3"; pyproject = true; disabled = pythonOlder "3.9"; @@ -35,7 +35,7 @@ buildPythonPackage rec { owner = "pymc-devs"; repo = "pytensor"; rev = "refs/tags/rel-${version}"; - hash = "sha256-u1CbOjU3rQ6G3SSwYR3UlebymkupGMJWID4RH4v9PIk="; + hash = "sha256-FufPCFzSjG8BrHes7t3XsdovX9gqUBG0gMDGKvkRkSA="; }; postPatch = '' diff --git a/pkgs/development/python-modules/pymyq/default.nix b/pkgs/development/python-modules/python-myq/default.nix index 91c691f843a39..f596828e6f9f3 100644 --- a/pkgs/development/python-modules/pymyq/default.nix +++ b/pkgs/development/python-modules/python-myq/default.nix @@ -9,7 +9,7 @@ }: buildPythonPackage rec { - pname = "pymyq"; + pname = "python-myq"; version = "3.1.13"; pyproject = true; diff --git a/pkgs/development/python-modules/readmdict/default.nix b/pkgs/development/python-modules/readmdict/default.nix new file mode 100644 index 0000000000000..b7d61f8c8f57d --- /dev/null +++ b/pkgs/development/python-modules/readmdict/default.nix @@ -0,0 +1,50 @@ +{ lib +, buildPythonPackage +, pythonOlder +, fetchFromGitHub + +, poetry-core +, python-lzo +, tkinter + +, pytestCheckHook +}: + +buildPythonPackage rec { + pname = "readmdict"; + version = "0.1.1"; + pyproject = true; + + disabled = pythonOlder "3.6"; + + src = fetchFromGitHub { + owner = "ffreemt"; + repo = "readmdict"; + rev = "v${version}"; + hash = "sha256-1/f+o2bVscT3EA8XQyS2hWjhimLRzfIBM6u2O7UqwcA="; + }; + + nativeBuildInputs = [ + poetry-core + ]; + + propagatedBuildInputs = [ + python-lzo + tkinter + ]; + + nativeCheckInputs = [ + pytestCheckHook + ]; + + pythonImportsCheck = [ + "readmdict" + ]; + + meta = with lib; { + description = "Read mdx/mdd files (repacking of readmdict from mdict-analysis)"; + homepage = "https://github.com/ffreemt/readmdict"; + license = licenses.mit; + maintainers = with maintainers; [ paveloom ]; + }; +} diff --git a/pkgs/development/python-modules/sensor-state-data/default.nix b/pkgs/development/python-modules/sensor-state-data/default.nix index 7316256cd8aac..7802340cedef2 100644 --- a/pkgs/development/python-modules/sensor-state-data/default.nix +++ b/pkgs/development/python-modules/sensor-state-data/default.nix @@ -10,7 +10,7 @@ buildPythonPackage rec { pname = "sensor-state-data"; - version = "2.17.1"; + version = "2.18.0"; format = "pyproject"; disabled = pythonOlder "3.9"; @@ -19,7 +19,7 @@ buildPythonPackage rec { owner = "Bluetooth-Devices"; repo = pname; rev = "refs/tags/v${version}"; - hash = "sha256-zfgkTBdE8UWwk+G3bLBThVjgU+m2QoPf1fzORyznEgs="; + hash = "sha256-wYYSS4lABCbIhmUU3z3Wh0+4zwpEzXl8Kk9gi6LBrbQ="; }; nativeBuildInputs = [ diff --git a/pkgs/development/python-modules/streamlit/default.nix b/pkgs/development/python-modules/streamlit/default.nix index b764d95734513..b764d95734513 100755..100644 --- a/pkgs/development/python-modules/streamlit/default.nix +++ b/pkgs/development/python-modules/streamlit/default.nix diff --git a/pkgs/development/python-modules/textparser/default.nix b/pkgs/development/python-modules/textparser/default.nix new file mode 100644 index 0000000000000..86c436ac21f99 --- /dev/null +++ b/pkgs/development/python-modules/textparser/default.nix @@ -0,0 +1,39 @@ +{ lib +, buildPythonPackage +, fetchPypi +, setuptools-scm +, pytestCheckHook +, pythonOlder +}: + +buildPythonPackage rec { + pname = "textparser"; + version = "0.24.0"; + format = "setuptools"; + + disabled = pythonOlder "3.7"; + + src = fetchPypi { + inherit pname version; + hash = "sha256-VvcI51qp0AKtt22CO6bvFm1+zsHj5MpMHKED+BdWgzU="; + }; + + nativeBuildInputs = [ + setuptools-scm + ]; + + nativeCheckInputs = [ + pytestCheckHook + ]; + + pythonImportsCheck = [ + "textparser" + ]; + + meta = with lib; { + homepage = "https://github.com/eerimoq/textparser"; + description = "A text parser"; + license = licenses.mit; + maintainers = with maintainers; [ gray-heron ]; + }; +} diff --git a/pkgs/development/python-modules/toonapi/default.nix b/pkgs/development/python-modules/toonapi/default.nix index 8df8fa89a2ca3..ac51cae1c805d 100644 --- a/pkgs/development/python-modules/toonapi/default.nix +++ b/pkgs/development/python-modules/toonapi/default.nix @@ -3,18 +3,22 @@ , backoff , buildPythonPackage , fetchFromGitHub +, pythonOlder , yarl }: buildPythonPackage rec { pname = "toonapi"; - version = "0.2.1"; + version = "0.3.0"; + format = "setuptools"; + + disabled = pythonOlder "3.8"; src = fetchFromGitHub { owner = "frenck"; repo = "python-toonapi"; - rev = "v${version}"; - sha256 = "10jh6p0ww51cb9f8amd9jq3lmvby6n2k08qwcr2n8ijbbgyp0ibf"; + rev = "refs/tags/v${version}"; + hash = "sha256-RaN9ppqJbTik1/vNX0/YLoBawrqjyQWU6+FLTspIxug="; }; propagatedBuildInputs = [ @@ -25,11 +29,15 @@ buildPythonPackage rec { # Project has no tests doCheck = false; - pythonImportsCheck = [ "toonapi" ]; + + pythonImportsCheck = [ + "toonapi" + ]; meta = with lib; { description = "Python client for the Quby ToonAPI"; homepage = "https://github.com/frenck/python-toonapi"; + changelog = "https://github.com/frenck/python-toonapi/releases/tag/v${version}"; license = with licenses; [ mit ]; maintainers = with maintainers; [ fab ]; }; diff --git a/pkgs/development/python-modules/twentemilieu/default.nix b/pkgs/development/python-modules/twentemilieu/default.nix index aa91f01686c71..e52f70753f327 100644 --- a/pkgs/development/python-modules/twentemilieu/default.nix +++ b/pkgs/development/python-modules/twentemilieu/default.nix @@ -12,16 +12,16 @@ buildPythonPackage rec { pname = "twentemilieu"; - version = "1.0.0"; + version = "2.0.0"; format = "pyproject"; - disabled = pythonOlder "3.10"; + disabled = pythonOlder "3.11"; src = fetchFromGitHub { owner = "frenck"; repo = "python-twentemilieu"; - rev = "v${version}"; - hash = "sha256-MTAVa5gP5e8TIE/i1DjfmwKm1zDVC/WEcYKxZSV/+Ug="; + rev = "refs/tags/v${version}"; + hash = "sha256-r0LZS8TXux1mzzXBTSu+x5sxUZOCzW7poKG3dQ2A6No="; }; postPatch = '' @@ -45,7 +45,9 @@ buildPythonPackage rec { pytestCheckHook ]; - pythonImportsCheck = [ "twentemilieu" ]; + pythonImportsCheck = [ + "twentemilieu" + ]; meta = with lib; { description = "Python client for Twente Milieu"; diff --git a/pkgs/development/python-modules/vehicle/default.nix b/pkgs/development/python-modules/vehicle/default.nix index e1d4531719b4d..a233b51773ac1 100644 --- a/pkgs/development/python-modules/vehicle/default.nix +++ b/pkgs/development/python-modules/vehicle/default.nix @@ -13,16 +13,16 @@ buildPythonPackage rec { pname = "vehicle"; - version = "1.0.1"; + version = "2.0.0"; format = "pyproject"; - disabled = pythonOlder "3.10"; + disabled = pythonOlder "3.11"; src = fetchFromGitHub { owner = "frenck"; repo = "python-vehicle"; rev = "refs/tags/v${version}"; - hash = "sha256-nN7efkN59FCCjCk3svYCTGGdvr2RSM5VektuUkHy3Vo="; + hash = "sha256-EbjrAfbqVY336RHBWq81KM+oHixen+38aUTnWZQ+nCs="; }; nativeBuildInputs = [ diff --git a/pkgs/development/python-modules/wallbox/default.nix b/pkgs/development/python-modules/wallbox/default.nix index 4fe26418ef830..a53344a76fd17 100644 --- a/pkgs/development/python-modules/wallbox/default.nix +++ b/pkgs/development/python-modules/wallbox/default.nix @@ -9,14 +9,14 @@ buildPythonPackage rec { pname = "wallbox"; - version = "0.4.14"; + version = "0.5.1"; format = "setuptools"; disabled = pythonOlder "3.7"; src = fetchPypi { inherit pname version; - hash = "sha256-HKlq5DPG3HD9i9LLTJdlzEFim+2hBdSfKl43BojhEf8="; + hash = "sha256-EDEB7/CkrfYSNcSh55Itrj6rThsNKeuj8lHLAY+Qml4="; }; propagatedBuildInputs = [ diff --git a/pkgs/development/python-modules/zstandard/default.nix b/pkgs/development/python-modules/zstandard/default.nix index 2da5ae524bb39..2da5ae524bb39 100755..100644 --- a/pkgs/development/python-modules/zstandard/default.nix +++ b/pkgs/development/python-modules/zstandard/default.nix diff --git a/pkgs/development/tools/analysis/checkov/default.nix b/pkgs/development/tools/analysis/checkov/default.nix index f9655b201746e..34bb4303724b0 100644 --- a/pkgs/development/tools/analysis/checkov/default.nix +++ b/pkgs/development/tools/analysis/checkov/default.nix @@ -22,14 +22,14 @@ with py.pkgs; buildPythonApplication rec { pname = "checkov"; - version = "2.5.14"; + version = "2.5.15"; format = "setuptools"; src = fetchFromGitHub { owner = "bridgecrewio"; repo = pname; rev = "refs/tags/${version}"; - hash = "sha256-4F8cGcQJy8cbCE0wxM6B4qGjuc+SjeL7DMr6RdSkXBM="; + hash = "sha256-PVx66Ipvf+rISkuu9dw2ecFXXmuzITg2PogqRktFh5M="; }; patches = [ diff --git a/pkgs/development/tools/analysis/rizin/default.nix b/pkgs/development/tools/analysis/rizin/default.nix index e6b20bd5e1595..d4bd1e84b112f 100644 --- a/pkgs/development/tools/analysis/rizin/default.nix +++ b/pkgs/development/tools/analysis/rizin/default.nix @@ -25,11 +25,11 @@ let rizin = stdenv.mkDerivation rec { pname = "rizin"; - version = "0.6.2"; + version = "0.6.3"; src = fetchurl { url = "https://github.com/rizinorg/rizin/releases/download/v${version}/rizin-src-v${version}.tar.xz"; - hash = "sha256-4poAo+IgBL3RAUbShrHM4OBhltQarkcpqvydeDIf+Gs="; + hash = "sha256-lfZMarnm2qnp+lY0OY649s206/LoFNouTLlp0x9FCcI="; }; mesonFlags = [ diff --git a/pkgs/development/tools/clj-kondo/default.nix b/pkgs/development/tools/clj-kondo/default.nix index 20f905a50ec99..dc78761cc256d 100644 --- a/pkgs/development/tools/clj-kondo/default.nix +++ b/pkgs/development/tools/clj-kondo/default.nix @@ -2,11 +2,11 @@ buildGraalvmNativeImage rec { pname = "clj-kondo"; - version = "2023.09.07"; + version = "2023.10.20"; src = fetchurl { url = "https://github.com/clj-kondo/${pname}/releases/download/v${version}/${pname}-${version}-standalone.jar"; - sha256 = "sha256-F7ePdITYKkGB6nsR3EFJ7zLDCUoT0g3i+AAjXzBd624="; + sha256 = "sha256-f9u/pk3CEEmiLgnS2biaUHpsMHjVEwZL2jyB/1PiZUY="; }; extraNativeImageBuildArgs = [ diff --git a/pkgs/development/tools/misc/texlab/default.nix b/pkgs/development/tools/misc/texlab/default.nix index e33a288286ee2..9bc36338ff2e3 100644 --- a/pkgs/development/tools/misc/texlab/default.nix +++ b/pkgs/development/tools/misc/texlab/default.nix @@ -15,16 +15,16 @@ let in rustPlatform.buildRustPackage rec { pname = "texlab"; - version = "5.10.0"; + version = "5.10.1"; src = fetchFromGitHub { owner = "latex-lsp"; repo = "texlab"; rev = "refs/tags/v${version}"; - hash = "sha256-MTWaGgDIDo3CaRHyHWqliKsPdbU/TZPsyfF7SoHTnhk="; + hash = "sha256-ACdiFkV138jDIrRe+baYo+r9vCO4cyRyO2ck7OKakFY="; }; - cargoHash = "sha256-8Vrp4d5luf91pKpUC4wWn4otsanqopCHwCjcnfTzyLk="; + cargoHash = "sha256-bEeQOOucXd4HNTR6SmidAfDkZ1tT7ORmUxrNx+3FNRw="; outputs = [ "out" ] ++ lib.optional (!isCross) "man"; @@ -41,7 +41,7 @@ rustPlatform.buildRustPackage rec { # generate the man page postInstall = lib.optionalString (!isCross) '' # TexLab builds man page separately in CI: - # https://github.com/latex-lsp/texlab/blob/v5.9.2/.github/workflows/publish.yml#L117-L121 + # https://github.com/latex-lsp/texlab/blob/v5.10.1/.github/workflows/publish.yml#L117-L121 help2man --no-info "$out/bin/texlab" > texlab.1 installManPage texlab.1 ''; diff --git a/pkgs/development/tools/poetry2nix/poetry2nix/overrides/build-systems.json b/pkgs/development/tools/poetry2nix/poetry2nix/overrides/build-systems.json index 04174d1c43540..2e859c6ddbf54 100644 --- a/pkgs/development/tools/poetry2nix/poetry2nix/overrides/build-systems.json +++ b/pkgs/development/tools/poetry2nix/poetry2nix/overrides/build-systems.json @@ -2732,6 +2732,9 @@ "certbot-dns-inwx": [ "setuptools" ], + "certbot-dns-ovh": [ + "setuptools" + ], "certbot-dns-rfc2136": [ "setuptools" ], diff --git a/pkgs/development/tools/railway/default.nix b/pkgs/development/tools/railway/default.nix index 1d075250a4157..688a475a1403f 100644 --- a/pkgs/development/tools/railway/default.nix +++ b/pkgs/development/tools/railway/default.nix @@ -3,16 +3,16 @@ rustPlatform.buildRustPackage rec { pname = "railway"; - version = "3.4.0"; + version = "3.5.0"; src = fetchFromGitHub { owner = "railwayapp"; repo = "cli"; rev = "v${version}"; - hash = "sha256-pydnIUqUBMLHonEGcvB+K+48QQYQuFfZxbAETJjU+3o="; + hash = "sha256-I32DC0hzVM/LCSqS878sZd+UYZ0NfBuzBgd9Aed/Sq0="; }; - cargoHash = "sha256-VgLQfUk1xeAwr9KUo1Vz4Ndw0FAnYGw3af0v3ueNPuA="; + cargoHash = "sha256-CYy0YEWK9sHAr0yFIH9yzxPnzG6x/EcE8ZLkueYgSiE="; nativeBuildInputs = [ pkg-config ]; diff --git a/pkgs/games/steam/fhsenv.nix b/pkgs/games/steam/fhsenv.nix index a6734b640638e..78c669614c07d 100644 --- a/pkgs/games/steam/fhsenv.nix +++ b/pkgs/games/steam/fhsenv.nix @@ -3,6 +3,7 @@ , extraPkgs ? pkgs: [ ] # extra packages to add to targetPkgs , extraLibraries ? pkgs: [ ] # extra packages to add to multiPkgs , extraProfile ? "" # string to append to profile +, extraBwrapArgs ? [ ] # extra arguments to pass to bubblewrap , extraArgs ? "" # arguments to always pass to steam , extraEnv ? { } # Environment variables to pass to Steam , withGameSpecificLibraries ? true # include game specific libraries @@ -277,6 +278,8 @@ in buildFHSEnv rec { exec steam ${extraArgs} "$@" ''; + inherit extraBwrapArgs; + meta = if steam != null then @@ -287,21 +290,11 @@ in buildFHSEnv rec { description = "Steam dependencies (dummy package, do not use)"; }; - # allows for some gui applications to share IPC - # this fixes certain issues where they don't render correctly - unshareIpc = false; - - # Some applications such as Natron need access to MIT-SHM or other - # shared memory mechanisms. Unsharing the pid namespace - # breaks the ability for application to reference shared memory. - unsharePid = false; - passthru.run = buildFHSEnv { name = "steam-run"; targetPkgs = commonTargetPkgs; - inherit multiArch multiPkgs profile extraInstallCommands; - inherit unshareIpc unsharePid; + inherit multiArch multiPkgs profile extraInstallCommands extraBwrapArgs; runScript = writeShellScript "steam-run" '' run="$1" diff --git a/pkgs/misc/uq/default.nix b/pkgs/misc/uq/default.nix index 81c09685be8b6..81c09685be8b6 100755..100644 --- a/pkgs/misc/uq/default.nix +++ b/pkgs/misc/uq/default.nix diff --git a/pkgs/os-specific/linux/kernel/zen-kernels.nix b/pkgs/os-specific/linux/kernel/zen-kernels.nix index 716a45820ca52..f978cb429df5f 100644 --- a/pkgs/os-specific/linux/kernel/zen-kernels.nix +++ b/pkgs/os-specific/linux/kernel/zen-kernels.nix @@ -4,16 +4,16 @@ let # comments with variant added for update script # ./update-zen.py zen zenVariant = { - version = "6.5.7"; #zen - suffix = "zen2"; #zen - sha256 = "0qy3xn7kr16crm7iw1zhm3kpgxpmn66xc4g1yalvghwn6si0n81l"; #zen + version = "6.5.8"; #zen + suffix = "zen1"; #zen + sha256 = "0pg5q5alsxrbbf8hzbcgmwsyirs86715qijdzaldyw9sf74h4z1l"; #zen isLqx = false; }; # ./update-zen.py lqx lqxVariant = { - version = "6.5.7"; #lqx + version = "6.5.8"; #lqx suffix = "lqx1"; #lqx - sha256 = "1c4093xhfnzx6h8frqcigdlikgy1n0vv34ajs0237v3w7psw99d7"; #lqx + sha256 = "1f10p7mriwjrgmdfz10vs48xiipdk9ljj884fsj63r5n1g7pz4bf"; #lqx isLqx = true; }; zenKernelsFor = { version, suffix, sha256, isLqx }: buildLinux (args // { diff --git a/pkgs/os-specific/linux/minimal-bootstrap/stage0-posix/bootstrap-sources.nix b/pkgs/os-specific/linux/minimal-bootstrap/stage0-posix/bootstrap-sources.nix index a0663c9dbe4f9..715d261eea4f5 100644 --- a/pkgs/os-specific/linux/minimal-bootstrap/stage0-posix/bootstrap-sources.nix +++ b/pkgs/os-specific/linux/minimal-bootstrap/stage0-posix/bootstrap-sources.nix @@ -1,4 +1,4 @@ -{ +{ hostPlatform }: rec { @@ -65,7 +65,7 @@ rec { */ minimal-bootstrap-sources = derivation { inherit name; - system = builtins.currentSystem; + system = hostPlatform.system; outputHashMode = "recursive"; inherit outputHashAlgo outputHash; diff --git a/pkgs/os-specific/linux/minimal-bootstrap/stage0-posix/make-bootstrap-sources.nix b/pkgs/os-specific/linux/minimal-bootstrap/stage0-posix/make-bootstrap-sources.nix index 381902cd2c129..6cc7cddb82af4 100644 --- a/pkgs/os-specific/linux/minimal-bootstrap/stage0-posix/make-bootstrap-sources.nix +++ b/pkgs/os-specific/linux/minimal-bootstrap/stage0-posix/make-bootstrap-sources.nix @@ -12,12 +12,13 @@ # { lib +, hostPlatform , fetchFromGitHub , fetchpatch }: let - expected = import ./bootstrap-sources.nix { }; + expected = import ./bootstrap-sources.nix { inherit hostPlatform; }; in fetchFromGitHub { diff --git a/pkgs/os-specific/linux/oci-seccomp-bpf-hook/default.nix b/pkgs/os-specific/linux/oci-seccomp-bpf-hook/default.nix index 40ef0796dfa1e..61a27bd51f029 100644 --- a/pkgs/os-specific/linux/oci-seccomp-bpf-hook/default.nix +++ b/pkgs/os-specific/linux/oci-seccomp-bpf-hook/default.nix @@ -10,12 +10,12 @@ buildGoModule rec { pname = "oci-seccomp-bpf-hook"; - version = "1.2.9"; + version = "1.2.10"; src = fetchFromGitHub { owner = "containers"; repo = "oci-seccomp-bpf-hook"; rev = "v${version}"; - sha256 = "sha256-KPO9xqLgPML6smoO7P50yP81b4iCvRFIR74ciUiva7o="; + sha256 = "sha256-bWlm+JYNf7+faKSQfW5fhxoH/D2I8ujjakswH+1r49o="; }; vendorHash = null; diff --git a/pkgs/servers/home-assistant/component-packages.nix b/pkgs/servers/home-assistant/component-packages.nix index 128f20777fe2c..79195bd7152ea 100644 --- a/pkgs/servers/home-assistant/component-packages.nix +++ b/pkgs/servers/home-assistant/component-packages.nix @@ -2771,7 +2771,8 @@ sqlalchemy ]; "myq" = ps: with ps; [ - ]; # missing inputs: python-myq + python-myq + ]; "mysensors" = ps: with ps; [ aiohttp-cors janus @@ -5405,6 +5406,7 @@ "mullvad" "mutesync" "my" + "myq" "mysensors" "mystrom" "mythicbeastsdns" diff --git a/pkgs/servers/http/apache-httpd/2.4.nix b/pkgs/servers/http/apache-httpd/2.4.nix index 98a00afc519d4..c6e7ad1f56616 100644 --- a/pkgs/servers/http/apache-httpd/2.4.nix +++ b/pkgs/servers/http/apache-httpd/2.4.nix @@ -13,11 +13,11 @@ stdenv.mkDerivation rec { pname = "apache-httpd"; - version = "2.4.57"; + version = "2.4.58"; src = fetchurl { url = "mirror://apache/httpd/httpd-${version}.tar.bz2"; - sha256 = "sha256-28y4Su6V4JXt+7geXrkmzNJOatpV3Ng8rssmLlz5TSo="; + sha256 = "sha256-+hbXKgeCEKVMR91b7y+Lm4oB2UkJpRRTlWs+xkQupMU="; }; # FIXME: -dev depends on -doc diff --git a/pkgs/servers/http/lighttpd/default.nix b/pkgs/servers/http/lighttpd/default.nix index b0bb720c21cdd..0c83c2e750a03 100644 --- a/pkgs/servers/http/lighttpd/default.nix +++ b/pkgs/servers/http/lighttpd/default.nix @@ -15,26 +15,15 @@ stdenv.mkDerivation rec { pname = "lighttpd"; - version = "1.4.71"; + version = "1.4.72"; src = fetchurl { url = "https://download.lighttpd.net/lighttpd/releases-${lib.versions.majorMinor version}.x/${pname}-${version}.tar.xz"; - sha256 = "sha256-uLaRXaIDlv3DVN8zJNXkQBabLl6nhZ46d1IThBMlr6w="; + sha256 = "sha256-98reTWm3VKB0jAFGPDPNi0VsqcwDuwnoWnG8vNVOVew="; }; - patches = [ - # disable tests for des/md5, which we don't support any more - ./disable-legacy-crypt-tests.patch - ]; - postPatch = '' patchShebangs tests - # Linux sandbox has an empty hostname and not /etc/hosts, which fails some tests - sed -ire '/[$]self->{HOSTNAME} *=/i if(length($name)==0) { $name = "127.0.0.1" }' tests/LightyTest.pm - # it's difficult to prevent this test from trying to use /var/tmp (which - # the sandbox doesn't have) so until libredirect has support for mkstemp - # calls it's easiest to disable it - sed -i '/test_mod_ssi/d' src/t/test_mod.c ''; depsBuildBuild = [ buildPackages.stdenv.cc ]; diff --git a/pkgs/servers/http/lighttpd/disable-legacy-crypt-tests.patch b/pkgs/servers/http/lighttpd/disable-legacy-crypt-tests.patch deleted file mode 100644 index 4a411c0b98aed..0000000000000 --- a/pkgs/servers/http/lighttpd/disable-legacy-crypt-tests.patch +++ /dev/null @@ -1,35 +0,0 @@ -diff -uNr lighttpd-1.4.71.orig/tests/mod-fastcgi.t lighttpd-1.4.71.new/tests/mod-fastcgi.t ---- lighttpd-1.4.71.orig/tests/mod-fastcgi.t 2023-05-27 21:56:16.000000000 +0200 -+++ lighttpd-1.4.71.new/tests/mod-fastcgi.t 2023-06-01 07:01:59.789873512 +0200 -@@ -79,7 +79,7 @@ - ok($tf->handle_http($t) == 0, 'FastCGI + bin-copy-environment'); - - SKIP: { -- skip "no crypt-des under openbsd or MS Visual Studio", 2 if $^O eq 'openbsd' || $tf->{'win32native'}; -+ skip "no crypt-des", 2; - - $t->{REQUEST} = ( <<EOF - GET /get-server-env.php?env=REMOTE_USER HTTP/1.0 -diff -uNr lighttpd-1.4.71.orig/tests/request.t lighttpd-1.4.71.new/tests/request.t ---- lighttpd-1.4.71.orig/tests/request.t 2023-05-27 21:56:16.000000000 +0200 -+++ lighttpd-1.4.71.new/tests/request.t 2023-06-01 07:02:39.855940048 +0200 -@@ -1106,7 +1106,7 @@ - ok($tf->handle_http($t) == 0, 'Basic-Auth: Valid Auth-token - plain'); - - SKIP: { -- skip "no crypt-des under openbsd or MS Visual Studio", 2 if $^O eq 'openbsd' || $tf->{'win32native'}; -+ skip "no crypt-des", 2; - $t->{REQUEST} = ( <<EOF - GET /server-config HTTP/1.0 - Host: auth-htpasswd.example.org -@@ -1163,9 +1163,7 @@ - ok($tf->handle_http($t) == 0, 'Basic-Auth: Valid Auth-token - htpasswd (apr-md5, wrong password)'); - - SKIP: { -- skip "no crypt-md5 under cygwin", 1 if $^O eq 'cygwin'; -- skip "no crypt-md5 under darwin", 1 if $^O eq 'darwin'; -- skip "no crypt-md5 under openbsd",1 if $^O eq 'openbsd'; -+ skip "no crypt-md5", 1; - $t->{REQUEST} = ( <<EOF - GET /server-config HTTP/1.0 - Host: auth-htpasswd.example.org diff --git a/pkgs/servers/http/tomcat/tomcat-native.nix b/pkgs/servers/http/tomcat/tomcat-native.nix index 5f9ea8a1665d5..bd05943ac71f9 100644 --- a/pkgs/servers/http/tomcat/tomcat-native.nix +++ b/pkgs/servers/http/tomcat/tomcat-native.nix @@ -2,11 +2,11 @@ stdenv.mkDerivation rec { pname = "tomcat-native"; - version = "2.0.5"; + version = "2.0.6"; src = fetchurl { url = "mirror://apache/tomcat/tomcat-connectors/native/${version}/source/${pname}-${version}-src.tar.gz"; - hash = "sha256-lY0fEhZRwQxhVW133J0NQfO1OYiiGVRC3krG9MuHg4g="; + hash = "sha256-vmF8V26SO2B50LdSBtcG2ifdBDzr9Qv7leOpwKodGjU="; }; sourceRoot = "${pname}-${version}-src/native"; diff --git a/pkgs/servers/monitoring/librenms/default.nix b/pkgs/servers/monitoring/librenms/default.nix index 79b550e281466..0fab1b334890e 100644 --- a/pkgs/servers/monitoring/librenms/default.nix +++ b/pkgs/servers/monitoring/librenms/default.nix @@ -23,7 +23,6 @@ let phpPackage = php82.withExtensions ({ enabled, all }: enabled ++ [ all.memcached ]); in phpPackage.buildComposerProject rec { - name = pname + "-" + version; pname = "librenms"; version = "23.9.1"; diff --git a/pkgs/servers/teleport/11/default.nix b/pkgs/servers/teleport/11/default.nix index 59d788872b887..3a935b630e721 100644 --- a/pkgs/servers/teleport/11/default.nix +++ b/pkgs/servers/teleport/11/default.nix @@ -1,7 +1,7 @@ { callPackage, ... }@args: callPackage ../generic.nix ({ - version = "11.3.25"; - hash = "sha256-KIbRn90BUJp8Uc8GMHuIMMSn5tJQbxzE0ntngx1ELaE="; + version = "11.3.27"; + hash = "sha256-A3EeFQsDOaggfb5S+eyRCe/vm054MabfRrcHPxhO0So="; vendorHash = "sha256-hjMv/H4dlinlv3ku7i1km2/b+6uCdbznHtVOMIjDlUc="; yarnHash = "sha256-hip0WQVZpx2qfVDmEy4nk4UFYEjX1Xhj8HsIIQ8PF1Y="; cargoLock = { diff --git a/pkgs/servers/teleport/12/Cargo.lock b/pkgs/servers/teleport/12/Cargo.lock index 895145e3927f6..c150d003f3ac4 100644 --- a/pkgs/servers/teleport/12/Cargo.lock +++ b/pkgs/servers/teleport/12/Cargo.lock @@ -1734,9 +1734,9 @@ dependencies = [ [[package]] name = "webpki" -version = "0.22.0" +version = "0.22.2" source = "registry+https://github.com/rust-lang/crates.io-index" -checksum = "f095d78192e208183081cc07bc5515ef55216397af48b873e5edcd72637fa1bd" +checksum = "07ecc0cd7cac091bf682ec5efa18b1cff79d617b84181f38b3951dbe135f607f" dependencies = [ "ring", "untrusted 0.7.1", diff --git a/pkgs/servers/teleport/12/default.nix b/pkgs/servers/teleport/12/default.nix index e53fdcce494a4..ee166f5d4721a 100644 --- a/pkgs/servers/teleport/12/default.nix +++ b/pkgs/servers/teleport/12/default.nix @@ -1,9 +1,9 @@ { callPackage, ... }@args: callPackage ../generic.nix ({ - version = "12.4.20"; - hash = "sha256-Qz+JOS4YPj2865Fkj7eVJMdilHMOGbTD179bQ5wHY7A="; - vendorHash = "sha256-cS8ylLujgp9Is+D2JjoK4yGgWRCVRyRw3NPQAAuE2vY="; - yarnHash = "sha256-tOdT7X8jM+tl1GZ7lBN2aW8KRiVW/zWK9fZIU7CSHVE="; + version = "12.4.22"; + hash = "sha256-UEiS+GiderYTU34GHsQr4G8XrasV5ewmPcdrec4v5B4="; + vendorHash = "sha256-etutgK/5u+e86kx7ha3x+di9np7Tcr7hpGUMKZxJNT4="; + yarnHash = "sha256-MBTElkMH5rb33l+AYWH+zguSLQf+ntXpOkHZpjLAx/Q="; cargoLock = { lockFile = ./Cargo.lock; outputHashes = { diff --git a/pkgs/servers/teleport/13/Cargo.lock b/pkgs/servers/teleport/13/Cargo.lock index b82c0b0e435f7..d22467c3e7dce 100644 --- a/pkgs/servers/teleport/13/Cargo.lock +++ b/pkgs/servers/teleport/13/Cargo.lock @@ -1786,9 +1786,9 @@ dependencies = [ [[package]] name = "webpki" -version = "0.22.0" +version = "0.22.2" source = "registry+https://github.com/rust-lang/crates.io-index" -checksum = "f095d78192e208183081cc07bc5515ef55216397af48b873e5edcd72637fa1bd" +checksum = "07ecc0cd7cac091bf682ec5efa18b1cff79d617b84181f38b3951dbe135f607f" dependencies = [ "ring", "untrusted 0.7.1", diff --git a/pkgs/servers/teleport/13/default.nix b/pkgs/servers/teleport/13/default.nix index 58d682f52ac2e..65cbed70d9cc2 100644 --- a/pkgs/servers/teleport/13/default.nix +++ b/pkgs/servers/teleport/13/default.nix @@ -1,9 +1,9 @@ { callPackage, ... }@args: callPackage ../generic.nix ({ - version = "13.4.1"; - hash = "sha256-wgSaek4eq5Jx9SZFenvdRSU1wEtfJHzTz9GdczzUU2w="; - vendorHash = "sha256-DesT18nV/SxOsKCC+Nt0hgtH7CRtRL0B5FQhE1J148I="; - yarnHash = "sha256-iyMcP9L6dwBhN8JL9eSVEzsXI2EOjfyxjF9Dm4Gs04s="; + version = "13.4.3"; + hash = "sha256-x8G94jKycK3nYwqDA5RPc63GHIk9y4pHfSwSBqGBINk="; + vendorHash = "sha256-Pb3eO9zqLgTD7otM7yGRWicQjvpIXg7xKV8Oc4yh8PA="; + yarnHash = "sha256-GnoiLqzqGV0UZm5zePCDBUUX63NTIIo1dcxtiWQDPqc="; cargoLock = { lockFile = ./Cargo.lock; outputHashes = { diff --git a/pkgs/servers/teleport/14/Cargo.lock b/pkgs/servers/teleport/14/Cargo.lock index 8b18ac74ae704..c9b50a388b0ba 100644 --- a/pkgs/servers/teleport/14/Cargo.lock +++ b/pkgs/servers/teleport/14/Cargo.lock @@ -1789,9 +1789,9 @@ dependencies = [ [[package]] name = "webpki" -version = "0.22.0" +version = "0.22.2" source = "registry+https://github.com/rust-lang/crates.io-index" -checksum = "f095d78192e208183081cc07bc5515ef55216397af48b873e5edcd72637fa1bd" +checksum = "07ecc0cd7cac091bf682ec5efa18b1cff79d617b84181f38b3951dbe135f607f" dependencies = [ "ring", "untrusted 0.7.1", diff --git a/pkgs/servers/teleport/14/default.nix b/pkgs/servers/teleport/14/default.nix index 15a594ef13e65..71036da070ef1 100644 --- a/pkgs/servers/teleport/14/default.nix +++ b/pkgs/servers/teleport/14/default.nix @@ -1,9 +1,9 @@ { callPackage, ... }@args: callPackage ../generic.nix ({ - version = "14.0.1"; - hash = "sha256-esQwk2PFnk3/REzLr3ExtzEcUs2q4Tn/2KpfFWAx5uU="; - vendorHash = "sha256-lzwrkW0dHxCHBSJjzNhXgq3Av8Zj8xEn3kfTRtT/q04="; - yarnHash = "sha256-Y2dVxRyKPLD2xjwr0QqrKHf/4gnMCErmDzievu5zTGg="; + version = "14.0.3"; + hash = "sha256-X+vekYmuTE7n22SH/z2GWO3wnBsIef1GEjR7WOJpjc8="; + vendorHash = "sha256-+R6f2HrlN/RLec83YutccDFJW6gq6HXbxoJVtxMgdp8="; + yarnHash = "sha256-udM4DNaTGiMkqfkllJjmT+Nk6PNbGUzT34ixQOhmScw="; cargoLock = { lockFile = ./Cargo.lock; outputHashes = { diff --git a/pkgs/servers/unifi-video/default.nix b/pkgs/servers/unifi-video/default.nix index 45a9b5c6fb61e..45a9b5c6fb61e 100755..100644 --- a/pkgs/servers/unifi-video/default.nix +++ b/pkgs/servers/unifi-video/default.nix diff --git a/pkgs/stdenv/linux/default.nix b/pkgs/stdenv/linux/default.nix index 5c03312cc75f0..35cdb6311df32 100644 --- a/pkgs/stdenv/linux/default.nix +++ b/pkgs/stdenv/linux/default.nix @@ -68,7 +68,7 @@ mipsel-linux = import ./bootstrap-files/mipsel-unknown-linux-gnu.nix; mips64el-linux = import (if localSystem.isMips64n32 - then ./bootstrap-files/mips64el-unknown-linux-gnuabin32.nix.nix + then ./bootstrap-files/mips64el-unknown-linux-gnuabin32.nix else ./bootstrap-files/mips64el-unknown-linux-gnuabi64.nix); powerpc64le-linux = import ./bootstrap-files/powerpc64le-unknown-linux-gnu.nix; riscv64-linux = import ./bootstrap-files/riscv64-unknown-linux-gnu.nix; diff --git a/pkgs/tools/X11/xssstate/default.nix b/pkgs/tools/X11/xssstate/default.nix index a1ce545a5f133..53fd1138c29dd 100644 --- a/pkgs/tools/X11/xssstate/default.nix +++ b/pkgs/tools/X11/xssstate/default.nix @@ -4,29 +4,31 @@ , libX11 , libXScrnSaver }: -stdenv.mkDerivation rec { +stdenv.mkDerivation (finalAttrs: { pname = "xssstate"; - # - # Use the date of the last commit, since there were bug fixes after the 1.1 - # release. - # - version = "unstable-2022-09-24"; + version = "1.1-unstable-2022-09-24"; + src = fetchgit { url = "https://git.suckless.org/xssstate/"; rev = "5d8e9b49ce2970f786f1e5aa12bbaae83900453f"; hash = "sha256-Aor12tU1I/qNZCdBhZcvNK1FWFh0HYK8CEI29X5yoeA="; }; - makeFlags = [ "VERSION=${version}" ]; - - installFlags = [ "PREFIX=$(out)" ]; + buildInputs = [ + libX11 + libXScrnSaver + ]; - buildInputs = [ libX11 libXScrnSaver ]; + makeFlags = [ + "PREFIX=${placeholder "out"}" + "VERSION=${finalAttrs.version}" + ]; meta = with lib; { description = "A simple tool to retrieve the X screensaver state"; license = licenses.mit; maintainers = with maintainers; [ onemoresuza ]; platforms = platforms.linux; + mainProgram = "xssstate"; }; -} +}) diff --git a/pkgs/tools/admin/syft/default.nix b/pkgs/tools/admin/syft/default.nix index 3f6567b09f0c8..c596c709977c2 100644 --- a/pkgs/tools/admin/syft/default.nix +++ b/pkgs/tools/admin/syft/default.nix @@ -2,13 +2,13 @@ buildGoModule rec { pname = "syft"; - version = "0.92.0"; + version = "0.93.0"; src = fetchFromGitHub { owner = "anchore"; repo = pname; rev = "v${version}"; - hash = "sha256-YmzizpcAfE4+Rfq5ydQnDQBo4R+pAyudfi+fqD9EZP0="; + hash = "sha256-e8d+CK7rRbyHeRHOjK3tGFIBHuosdV4AMetUQar54E4="; # populate values that require us to use git. By doing this in postFetch we # can delete .git afterwards and maintain better reproducibility of the src. leaveDotGit = true; @@ -22,7 +22,7 @@ buildGoModule rec { }; # hash mismatch with darwin proxyVendor = true; - vendorHash = "sha256-siOZWhHqNokkYAPwuXQCs4T1yBiEWUTJzhfbH/Z2uBk="; + vendorHash = "sha256-BUCe2v80tHAqMBwa6xae3ZOTOok8msM6hFh6d9D4xZA="; nativeBuildInputs = [ installShellFiles ]; diff --git a/pkgs/tools/archivers/payload-dumper-go/default.nix b/pkgs/tools/archivers/payload-dumper-go/default.nix index bb1572e1ceb67..bb1572e1ceb67 100755..100644 --- a/pkgs/tools/archivers/payload-dumper-go/default.nix +++ b/pkgs/tools/archivers/payload-dumper-go/default.nix diff --git a/pkgs/tools/inputmethods/evsieve/default.nix b/pkgs/tools/inputmethods/evsieve/default.nix new file mode 100644 index 0000000000000..4497448cad129 --- /dev/null +++ b/pkgs/tools/inputmethods/evsieve/default.nix @@ -0,0 +1,31 @@ +{ lib +, fetchFromGitHub +, rustPlatform +, libevdev +}: + +rustPlatform.buildRustPackage rec { + pname = "evsieve"; + version = "1.3.1"; + + src = fetchFromGitHub { + owner = "KarsMulder"; + repo = "evsieve"; + rev = "v${version}"; + hash = "sha256-R/y3iyKGE4dzAyNnDwrMCr8JFshYJwNcgHQ8UbtuRj8="; + }; + + cargoHash = "sha256-jkm+mAHejCBZFalUbJNaIxtIl2kwnlPR2wsaYlcfSz8="; + + buildInputs = [ libevdev ]; + + doCheck = false; # unit tests create uinput devices + + meta = with lib; { + description = "A utility for mapping events from Linux event devices"; + homepage = "https://github.com/KarsMulder/evsieve"; + license = licenses.gpl2Plus; + maintainers = with maintainers; [ tsowell ]; + platforms = platforms.linux; + }; +} diff --git a/pkgs/tools/misc/ckb-next/default.nix b/pkgs/tools/misc/ckb-next/default.nix index f9309ecf81ddf..549cb543af192 100644 --- a/pkgs/tools/misc/ckb-next/default.nix +++ b/pkgs/tools/misc/ckb-next/default.nix @@ -1,17 +1,17 @@ -{ lib, mkDerivation, fetchFromGitHub, substituteAll, udev, stdenv +{ lib, wrapQtAppsHook, fetchFromGitHub, substituteAll, udev, stdenv , pkg-config, qtbase, cmake, zlib, kmod, libXdmcp, qttools, qtx11extras, libdbusmenu -, withPulseaudio ? stdenv.isLinux, libpulseaudio +, withPulseaudio ? stdenv.isLinux, libpulseaudio, quazip }: -mkDerivation rec { - version = "0.5.0"; +stdenv.mkDerivation rec { + version = "0.6.0"; pname = "ckb-next"; src = fetchFromGitHub { owner = "ckb-next"; repo = "ckb-next"; rev = "v${version}"; - sha256 = "sha256-yR1myagAqavAR/7lPdufcrJpPmXW7r4N4pxTMF6NbuE="; + hash = "sha256-G0cvET3wMIi4FlBmaTkdTyYtcdVGzK4X0C2HYZr43eg="; }; buildInputs = [ @@ -22,9 +22,11 @@ mkDerivation rec { qttools qtx11extras libdbusmenu + quazip ] ++ lib.optional withPulseaudio libpulseaudio; nativeBuildInputs = [ + wrapQtAppsHook pkg-config cmake ]; diff --git a/pkgs/tools/misc/esphome/default.nix b/pkgs/tools/misc/esphome/default.nix index b791cac21bd48..de7b7d5d03ef7 100644 --- a/pkgs/tools/misc/esphome/default.nix +++ b/pkgs/tools/misc/esphome/default.nix @@ -16,14 +16,14 @@ let in python.pkgs.buildPythonApplication rec { pname = "esphome"; - version = "2023.9.3"; + version = "2023.10.1"; format = "setuptools"; src = fetchFromGitHub { owner = pname; repo = pname; rev = "refs/tags/${version}"; - hash = "sha256-SyXEiGh1/s9EJ0UPYC8R04JUYkCPhCtNUcGvVCycKGM="; + hash = "sha256-XKZYnZYXETv0UXrKtjQvDXyv8lwqfO19jc5Fs3KMhEY="; }; postPatch = '' diff --git a/pkgs/tools/misc/starfetch/default.nix b/pkgs/tools/misc/starfetch/default.nix index ba6309c97ecbd..ba6309c97ecbd 100755..100644 --- a/pkgs/tools/misc/starfetch/default.nix +++ b/pkgs/tools/misc/starfetch/default.nix diff --git a/pkgs/tools/misc/szyszka/default.nix b/pkgs/tools/misc/szyszka/default.nix index 58d839acf0785..58d839acf0785 100755..100644 --- a/pkgs/tools/misc/szyszka/default.nix +++ b/pkgs/tools/misc/szyszka/default.nix diff --git a/pkgs/tools/networking/ddclient/default.nix b/pkgs/tools/networking/ddclient/default.nix new file mode 100644 index 0000000000000..6477c5b185c0e --- /dev/null +++ b/pkgs/tools/networking/ddclient/default.nix @@ -0,0 +1,53 @@ +{ lib, fetchFromGitHub, perlPackages, autoreconfHook, iproute2, perl, curl }: + +let + myPerl = perl.withPackages (ps: [ ps.JSONPP ]); +in +perlPackages.buildPerlPackage rec { + pname = "ddclient"; + version = "3.11.0_1"; + + outputs = [ "out" ]; + + src = fetchFromGitHub { + owner = "ddclient"; + repo = "ddclient"; + rev = "v${version}"; + sha256 = "sha256-pl1kbzY5nUIvx1QiDdL9TP4vKtQnnv3RWklE4gbxXCw="; + }; + + postPatch = '' + touch Makefile.PL + ''; + + nativeBuildInputs = [ autoreconfHook ]; + + buildInputs = [ curl myPerl ]; + + # Prevent ddclient from picking up build time perl which is implicitly added + # by buildPerlPackage. + configureFlags = [ + "--with-perl=${lib.getExe myPerl}" + ]; + + installPhase = '' + runHook preInstall + + install -Dm755 ddclient $out/bin/ddclient + install -Dm644 -t $out/share/doc/ddclient COP* README.* ChangeLog.md + + runHook postInstall + ''; + + # TODO: run upstream tests + doCheck = false; + + meta = with lib; { + description = "Client for updating dynamic DNS service entries"; + homepage = "https://ddclient.net/"; + license = licenses.gpl2Plus; + platforms = platforms.linux; + maintainers = with maintainers; [ bjornfor ]; + mainProgram = "ddclient"; + }; +} diff --git a/pkgs/tools/networking/ipfetch/default.nix b/pkgs/tools/networking/ipfetch/default.nix index b9b675366e56e..b9b675366e56e 100755..100644 --- a/pkgs/tools/networking/ipfetch/default.nix +++ b/pkgs/tools/networking/ipfetch/default.nix diff --git a/pkgs/tools/networking/voms/default.nix b/pkgs/tools/networking/voms/default.nix index a16648b9a8337..cafc812032b7a 100644 --- a/pkgs/tools/networking/voms/default.nix +++ b/pkgs/tools/networking/voms/default.nix @@ -13,7 +13,8 @@ , zlib # Configuration overridable with .override # If not null, the builder will - # move "$out/etc" to "$out/etc.orig" and symlink "$out/etc" to externalEtc. + # create a new output "etc", move "$out/etc" to "$etc/etc" + # and symlink "$out/etc" to externalEtc. , externalEtc ? "/etc" }: @@ -46,7 +47,8 @@ stdenv.mkDerivation rec{ zlib ]; - outputs = [ "bin" "out" "dev" "man" ]; + outputs = [ "bin" "out" "dev" "man" ] + ++ lib.optional (externalEtc != null) "etc"; preAutoreconf = '' mkdir -p aux src/autogen @@ -65,13 +67,12 @@ stdenv.mkDerivation rec{ configureFlags = [ "--with-gsoap-wsdl2h=${gsoap}/bin/wsdl2h" + "--sysconfdir=${placeholder "out"}/etc" ]; - postFixup = '' - ${lib.optionalString (externalEtc != null) '' - mv "$out"/etc{,.orig} - ln -s ${lib.escapeShellArg externalEtc} "$out/etc" - ''} + postFixup = lib.optionalString (externalEtc != null) '' + moveToOutput etc "$etc" + ln -s ${lib.escapeShellArg externalEtc} "$out/etc" ''; meta = with lib; { diff --git a/pkgs/tools/networking/xrootd/default.nix b/pkgs/tools/networking/xrootd/default.nix index 47496173642c6..e32139fdfcebd 100644 --- a/pkgs/tools/networking/xrootd/default.nix +++ b/pkgs/tools/networking/xrootd/default.nix @@ -39,7 +39,8 @@ stdenv.mkDerivation (finalAttrs: { hash = "sha256-SLmxv8opN7z4V07S9kLGo8HG7Ql62iZQLtf3zGemwA8="; }; - outputs = [ "bin" "out" "dev" "man" ]; + outputs = [ "bin" "out" "dev" "man" ] + ++ lib.optional (externalEtc != null) "etc"; passthru.fetchxrd = callPackage ./fetchxrd.nix { xrootd = finalAttrs.finalPackage; }; passthru.tests = @@ -118,7 +119,7 @@ stdenv.mkDerivation (finalAttrs: { wrapProgram "$FILE" "''${makeWrapperArgs[@]}" done < <(find "$bin/bin" -mindepth 1 -maxdepth 1 -type f,l -perm -a+x) '' + lib.optionalString (externalEtc != null) '' - mv "$out"/etc{,.orig} + moveToOutput etc "$etc" ln -s ${lib.escapeShellArg externalEtc} "$out/etc" ''; diff --git a/pkgs/tools/package-management/zkg/default.nix b/pkgs/tools/package-management/zkg/default.nix deleted file mode 100644 index 9d6700469722c..0000000000000 --- a/pkgs/tools/package-management/zkg/default.nix +++ /dev/null @@ -1,42 +0,0 @@ -{ lib -, python3 -, fetchFromGitHub -, pkgs -}: - -python3.pkgs.buildPythonApplication rec { - pname = "zkg"; - version = "2.14.0"; - format = "setuptools"; - - src = fetchFromGitHub { - owner = "zeek"; - repo = "package-manager"; - rev = "refs/tags/v${version}"; - hash = "sha256-HdOzxSU3XWz1ZH96woDWrHzKbpJW3/IKkpc2tGfyi9o="; - }; - - propagatedBuildInputs = with python3.pkgs; [ - btest - gitpython - semantic-version - sphinx - sphinx-rtd-theme - pkgs.bash - ]; - - # No tests available - doCheck = false; - - pythonImportsCheck = [ - "zeekpkg" - ]; - - meta = with lib; { - description = "Package manager for Zeek"; - homepage = "https://github.com/zeek/package-manager"; - changelog = "https://github.com/zeek/package-manager/blob/${version}/CHANGES"; - license = licenses.ncsa; - maintainers = with maintainers; [ fab ]; - }; -} diff --git a/pkgs/tools/security/nuclei/default.nix b/pkgs/tools/security/nuclei/default.nix index 1f6dd8baeeb1e..ae6e1d78f6fa8 100644 --- a/pkgs/tools/security/nuclei/default.nix +++ b/pkgs/tools/security/nuclei/default.nix @@ -5,18 +5,17 @@ buildGoModule rec { pname = "nuclei"; - version = "2.9.15"; + version = "3.0.1"; src = fetchFromGitHub { owner = "projectdiscovery"; repo = pname; rev = "refs/tags/v${version}"; - hash = "sha256-/7013cf9nnDiKqcwFOYZUF1D+wkQKXPBcwz3YhpBUK0="; + hash = "sha256-5Z40wc8ihN2UR3DyMCaD0MOKpgbUQX0OJMyZw2gVNYM="; }; - vendorHash = "sha256-b5CY66c2vfGaqlFENw2lnK47Cf2+buh/LtbJyPSAbOA="; + vendorHash = "sha256-CaeYAw7QU/KySFDSkUr4oHrG3wyPHxty3KCZ6zlPqIk="; - modRoot = "./v2"; subPackages = [ "cmd/nuclei/" ]; diff --git a/pkgs/tools/security/rekor/default.nix b/pkgs/tools/security/rekor/default.nix index 2820f473c11b9..c27416e29d2ee 100644 --- a/pkgs/tools/security/rekor/default.nix +++ b/pkgs/tools/security/rekor/default.nix @@ -4,13 +4,13 @@ let generic = { pname, packageToBuild, description }: buildGoModule rec { inherit pname; - version = "1.2.2"; + version = "1.3.2"; src = fetchFromGitHub { owner = "sigstore"; repo = "rekor"; rev = "v${version}"; - hash = "sha256-U7KxkPYVAy3/olXsEgPMX/kzg0KvYMovLO4LWw8guE4="; + hash = "sha256-QiK+ixVURf5Fsx9YPgzYCuCy1wYjxTUXGVr4FIn41Xc="; # populate values that require us to use git. By doing this in postFetch we # can delete .git afterwards and maintain better reproducibility of the src. leaveDotGit = true; @@ -23,7 +23,7 @@ let ''; }; - vendorHash = "sha256-hZyoVlNrPKE6ub94jVEOLGvxWoXKxFYcsEZyRrZuNkQ="; + vendorHash = "sha256-0379IX5W51Z48CffK1F2ZCPGLUq0g8lZXIQqaupC5io="; nativeBuildInputs = [ installShellFiles ]; diff --git a/pkgs/tools/security/scrypt/default.nix b/pkgs/tools/security/scrypt/default.nix index aad2873d4aca0..d2b8228f6511f 100644 --- a/pkgs/tools/security/scrypt/default.nix +++ b/pkgs/tools/security/scrypt/default.nix @@ -8,11 +8,11 @@ stdenv.mkDerivation rec { pname = "scrypt"; - version = "1.3.1"; + version = "1.3.2"; src = fetchurl { url = "https://www.tarsnap.com/scrypt/${pname}-${version}.tgz"; - sha256 = "1hnl0r6pmyxiy4dmafmqk1db7wpc0x9rqpzqcwr9d2cmghcj6byz"; + sha256 = "sha256-1jLBGTQgrG+uv5SC5l4z06VmTszWQ7CaUJ0h0cHym+I="; }; outputs = [ "out" "lib" "dev" ]; diff --git a/pkgs/tools/security/sequoia-sqop/default.nix b/pkgs/tools/security/sequoia-sqop/default.nix index f4cae90b546b8..fdefbdea9e503 100644 --- a/pkgs/tools/security/sequoia-sqop/default.nix +++ b/pkgs/tools/security/sequoia-sqop/default.nix @@ -9,7 +9,7 @@ rustPlatform.buildRustPackage rec { pname = "sequoia-sqop"; - version = "0.28.0"; + version = "0.30.0"; src = fetchFromGitLab { owner = "sequoia-pgp"; @@ -17,10 +17,10 @@ rustPlatform.buildRustPackage rec { # generated etc repo = "sequoia-sop"; rev = "v${version}"; - hash = "sha256-4A0eZMXzFtojRD5cXQQUVoS32sQ2lWtFll+q6yhnwG4="; + hash = "sha256-2fRlHkT2jhUp1dIqKe8r7ktSbgudCmzuiiyF0WcbYIE="; }; - cargoHash = "sha256-gH5WM+PmciViD+eFVlp8tzdc0KdYy1WZLQi92UEWVG4="; + cargoHash = "sha256-/LLW0AHCgqi2pAOkhZXNGlmNF/+u0TmSstd/B6mDr6M="; nativeBuildInputs = [ pkg-config diff --git a/pkgs/tools/security/uncover/default.nix b/pkgs/tools/security/uncover/default.nix index 1ea2f41447801..f0ee8aa23757f 100644 --- a/pkgs/tools/security/uncover/default.nix +++ b/pkgs/tools/security/uncover/default.nix @@ -5,16 +5,16 @@ buildGoModule rec { pname = "uncover"; - version = "1.0.6"; + version = "1.0.7"; src = fetchFromGitHub { owner = "projectdiscovery"; repo = pname; rev = "refs/tags/v${version}"; - hash = "sha256-FJtd73z6Cc56+nBderYncjrac3xRydDeoiJqn8xW29U="; + hash = "sha256-CJA+rDLubghaQT+yb0zQY3y8hF0/5ISH9YFvIQHwH2Y="; }; - vendorHash = "sha256-mpojOzGedkTthD+fHl9Uhul7tOCN1EGIin+7USoaNmE="; + vendorHash = "sha256-A7XPsl27Q5CaQXQUEvNB05B2M3mFGz/yZ4sOnOHxhw8="; meta = with lib; { description = "API wrapper to search for exposed hosts"; diff --git a/pkgs/tools/system/netdata/default.nix b/pkgs/tools/system/netdata/default.nix index 5d9286a1c4d1a..8ca73a4faf8c3 100644 --- a/pkgs/tools/system/netdata/default.nix +++ b/pkgs/tools/system/netdata/default.nix @@ -2,13 +2,13 @@ , CoreFoundation, IOKit, libossp_uuid , nixosTests , netdata-go-plugins -, bash, curl, jemalloc, libuv, zlib, libyaml +, bash, curl, jemalloc, json_c, libuv, zlib, libyaml , libcap, libuuid, lm_sensors, protobuf , withCups ? false, cups , withDBengine ? true, lz4 , withIpmi ? (!stdenv.isDarwin), freeipmi , withNetfilter ? (!stdenv.isDarwin), libmnl, libnetfilter_acct -, withCloud ? (!stdenv.isDarwin), json_c +, withCloud ? false , withCloudUi ? false , withConnPubSub ? false, google-cloud-cpp, grpc , withConnPrometheus ? false, snappy @@ -42,14 +42,13 @@ stdenv.mkDerivation rec { nativeBuildInputs = [ autoreconfHook pkg-config makeWrapper protobuf ]; # bash is only used to rewrite shebangs - buildInputs = [ bash curl jemalloc libuv zlib libyaml ] + buildInputs = [ bash curl jemalloc json_c libuv zlib libyaml ] ++ lib.optionals stdenv.isDarwin [ CoreFoundation IOKit libossp_uuid ] ++ lib.optionals (!stdenv.isDarwin) [ libcap libuuid ] ++ lib.optionals withCups [ cups ] ++ lib.optionals withDBengine [ lz4 ] ++ lib.optionals withIpmi [ freeipmi ] ++ lib.optionals withNetfilter [ libmnl libnetfilter_acct ] - ++ lib.optionals withCloud [ json_c ] ++ lib.optionals withConnPubSub [ google-cloud-cpp grpc ] ++ lib.optionals withConnPrometheus [ snappy ] ++ lib.optionals (withCloud || withConnPrometheus) [ protobuf ] diff --git a/pkgs/top-level/aliases.nix b/pkgs/top-level/aliases.nix index 9d2e755ca144a..c1d23ad8fba7b 100644 --- a/pkgs/top-level/aliases.nix +++ b/pkgs/top-level/aliases.nix @@ -92,7 +92,6 @@ mapAliases ({ bird2 = bird; # Added 2022-02-21 bitwig-studio1 = throw "bitwig-studio1 has been removed, you can upgrade to 'bitwig-studio'"; # Added 2023-01-03 bitwig-studio2 = throw "bitwig-studio2 has been removed, you can upgrade to 'bitwig-studio'"; # Added 2023-01-03 - ddclient = throw "ddclient has been removed on the request of the upstream maintainer because it is unmaintained and has bugs. Please switch to a different software like `inadyn` or `knsupdate`."; # Added 2023-07-04 bluezFull = throw "'bluezFull' has been renamed to/replaced by 'bluez'"; # Converted to throw 2023-09-10 boost168 = throw "boost168 has been deprecated in favor of the latest version"; # Added 2023-06-08 boost169 = throw "boost169 has been deprecated in favor of the latest version"; # Added 2023-06-08 @@ -973,6 +972,7 @@ mapAliases ({ ### Z ### zinc = zincsearch; # Added 2023-05-28 + zkg = throw "'zkg' has been replaced by 'zeek'"; zq = zed.overrideAttrs (old: { meta = old.meta // { mainProgram = "zq"; }; }); # Added 2023-02-06 ### UNSORTED ### diff --git a/pkgs/top-level/all-packages.nix b/pkgs/top-level/all-packages.nix index 860a152807e28..625231f133651 100644 --- a/pkgs/top-level/all-packages.nix +++ b/pkgs/top-level/all-packages.nix @@ -6977,6 +6977,8 @@ with pkgs; evdevremapkeys = callPackage ../tools/inputmethods/evdevremapkeys { }; + evsieve = callPackage ../tools/inputmethods/evsieve { }; + eyedropper = callPackage ../applications/graphics/eyedropper { }; persistent-evdev = python3Packages.callPackage ../servers/persistent-evdev { }; @@ -7425,6 +7427,8 @@ with pkgs; ddcutil = callPackage ../tools/misc/ddcutil { }; + ddclient = callPackage ../tools/networking/ddclient { }; + dd_rescue = callPackage ../tools/system/dd_rescue { }; ddh = callPackage ../tools/system/ddh { }; @@ -10259,6 +10263,10 @@ with pkgs; inherit (darwin.apple_sdk.frameworks) CoreFoundation IOKit; protobuf = protobuf3_21; }; + netdataCloud = netdata.override { + withCloud = !stdenv.isDarwin; + withCloudUi = true; + }; # Exposed here so the bots can auto-upgrade it netdata-go-plugins = callPackage ../tools/system/netdata/go.d.plugin.nix { }; @@ -12660,7 +12668,7 @@ with pkgs; rewrk = callPackage ../tools/networking/rewrk { }; - inherit (callPackage ../tools/security/rekor { }) + inherit (callPackage ../tools/security/rekor { buildGoModule = buildGo121Module; }) rekor-cli rekor-server; @@ -20840,6 +20848,8 @@ with pkgs; certbot-full = certbot.withPlugins (cp: with cp; [ certbot-dns-cloudflare + certbot-dns-google + certbot-dns-ovh certbot-dns-rfc2136 certbot-dns-route53 ]); @@ -24743,6 +24753,8 @@ with pkgs; readline82 = callPackage ../development/libraries/readline/8.2.nix { }; + readmdict = with python3Packages; toPythonApplication readmdict; + readosm = callPackage ../development/libraries/readosm { }; recastnavigation = callPackage ../development/libraries/recastnavigation { }; @@ -28318,7 +28330,9 @@ with pkgs; checkMeta = callPackage ../stdenv/generic/check-meta.nix { }; }); minimal-bootstrap-sources = callPackage ../os-specific/linux/minimal-bootstrap/stage0-posix/bootstrap-sources.nix { }; - make-minimal-bootstrap-sources = callPackage ../os-specific/linux/minimal-bootstrap/stage0-posix/make-bootstrap-sources.nix { }; + make-minimal-bootstrap-sources = callPackage ../os-specific/linux/minimal-bootstrap/stage0-posix/make-bootstrap-sources.nix { + inherit (stdenv) hostPlatform; + }; mingetty = callPackage ../os-specific/linux/mingetty { }; @@ -28443,7 +28457,9 @@ with pkgs; golint = callPackage ../development/tools/golint { }; - golangci-lint = callPackage ../development/tools/golangci-lint { }; + golangci-lint = callPackage ../development/tools/golangci-lint { + buildGoModule = buildGo121Module; + }; golangci-lint-langserver = callPackage ../development/tools/golangci-lint-langserver { }; @@ -29751,7 +29767,9 @@ with pkgs; nuclear = callPackage ../applications/audio/nuclear { }; - nuclei = callPackage ../tools/security/nuclei { }; + nuclei = callPackage ../tools/security/nuclei { + buildGoModule = buildGo121Module; + }; nullmailer = callPackage ../servers/mail/nullmailer { stdenv = gccStdenv; @@ -41488,8 +41506,6 @@ with pkgs; xbps = callPackage ../tools/package-management/xbps { }; - zkg = callPackage ../tools/package-management/zkg { }; - xcftools = callPackage ../tools/graphics/xcftools { }; xhyve = callPackage ../applications/virtualization/xhyve { diff --git a/pkgs/top-level/python-aliases.nix b/pkgs/top-level/python-aliases.nix index 66be4900a11b1..4e679de15084c 100644 --- a/pkgs/top-level/python-aliases.nix +++ b/pkgs/top-level/python-aliases.nix @@ -290,6 +290,7 @@ mapAliases ({ pymc3 = pymc; # added 2022-06-05, module was rename starting with 4.0.0 pymssql = throw "pymssql has been abandoned upstream."; # added 2020-05-04 PyMVGLive = pymvglive; # added 2023-02-19 + pymyq = python-myq; # added 2023-10-20 pyqt4 = throw "pyqt4 has been removed, because it depended on the long EOL qt4"; # added 2022-06-09 pyramid_beaker = pyramid-beaker; # added 2023-08-23 pyramid_chameleon = pyramid-chameleon; # added 2023-08-23 diff --git a/pkgs/top-level/python-packages.nix b/pkgs/top-level/python-packages.nix index 43a62d19c1a68..ac62b89f98822 100644 --- a/pkgs/top-level/python-packages.nix +++ b/pkgs/top-level/python-packages.nix @@ -198,6 +198,8 @@ self: super: with self; { aioecowitt = callPackage ../development/python-modules/aioecowitt { }; + aioelectricitymaps = callPackage ../development/python-modules/aioelectricitymaps { }; + aioemonitor = callPackage ../development/python-modules/aioemonitor { }; aioesphomeapi = callPackage ../development/python-modules/aioesphomeapi { }; @@ -1775,6 +1777,8 @@ self: super: with self; { canopen = callPackage ../development/python-modules/canopen { }; + cantools = callPackage ../development/python-modules/cantools { }; + camelot = callPackage ../development/python-modules/camelot { }; capstone = callPackage ../development/python-modules/capstone { @@ -1876,11 +1880,13 @@ self: super: with self; { certbot-dns-cloudflare = callPackage ../development/python-modules/certbot-dns-cloudflare { }; + certbot-dns-google = callPackage ../development/python-modules/certbot-dns-google { }; + certbot-dns-inwx = callPackage ../development/python-modules/certbot-dns-inwx { }; - certbot-dns-rfc2136 = callPackage ../development/python-modules/certbot-dns-rfc2136 { }; + certbot-dns-ovh = callPackage ../development/python-modules/certbot-dns-ovh { }; - certbot-dns-google = callPackage ../development/python-modules/certbot-dns-google { }; + certbot-dns-rfc2136 = callPackage ../development/python-modules/certbot-dns-rfc2136 { }; certbot-dns-route53 = callPackage ../development/python-modules/certbot-dns-route53 { }; @@ -10450,7 +10456,7 @@ self: super: with self; { pymvglive = callPackage ../development/python-modules/pymvglive { }; - pymyq = callPackage ../development/python-modules/pymyq { }; + python-myq = callPackage ../development/python-modules/python-myq { }; pymysensors = callPackage ../development/python-modules/pymysensors { }; @@ -12024,6 +12030,8 @@ self: super: with self; { readlike = callPackage ../development/python-modules/readlike { }; + readmdict = callPackage ../development/python-modules/readmdict { }; + readme = callPackage ../development/python-modules/readme { }; readme_renderer = callPackage ../development/python-modules/readme_renderer { }; @@ -13720,6 +13728,8 @@ self: super: with self; { textile = callPackage ../development/python-modules/textile { }; + textparser = callPackage ../development/python-modules/textparser { }; + textual = callPackage ../development/python-modules/textual { }; textual-universal-directorytree = callPackage ../development/python-modules/textual-universal-directorytree { }; |